Nội dung

Int.J.Curr.Microbiol.App.Sci (2020) 9(4): 1996-1999 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 9 Number 4 (2020) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2020.904.239 Single Nucleotide Polymorphism C-2161G in Promoter Region of Prolactin Gene in ‘N’ Strain of White Leghorn Azhaguraja Manoharan1*, S. Sankaralingam1, P. Anitha1, Binoj Chacko1 and T. V. Aravindakshan2 1 Department of Poultry Science, College of Veterinary and Animal Sciences, Mannuthy, Thrissur -680 651, Kerala, India 2 Department of Animal Breeding and Genetics, College of Veterinary and Animal Sciences, Mannuthy, Thrissur -680 651, Kerala, India *Corresponding author ABSTRACT Keywords Prolactin, SNP, PCR-RFLP, White Leghorn, Genotype Article Info Accepted: 15 March 2020 Available Online: 10 April 2020 Single nucleotide polymorphisms are the most commonly observed genetic variation among particular population, generally known as SNPs (pronounced “snips”). The main objective of the current research was recognition of SNP C-2161G in promoter region of prolactin gene in „N‟ strain of White Leghorn and its interrelation with production traits. A total of 200 birds of „N‟ strain of White Leghorn were randomly selected from All India Co-ordinated Research Project (AICRP) on Poultry Improvement, Mannuthy, Thrissur, Kerala. Blood samples were collected from the randomly selected birds and isolation of genomic DNA was done using DNA isolation kit. PCR and PCR-RFLP analysis was accomplished to detect a SNP at C-2161G site in promoter region of prolactin gene. The genotypes are represented as CC, CG and GG for C-2161G. All the 200 birds were noticed with same genotype (CC) and production performance. Introduction Prolactin (PRL) is a polypeptide hormone secreted by the adenohypophysis gland and it has been shown to have a broad spectrum of biological functions in all vertebrates. The chicken prolactin hormone plays a major role in egg production. At present marker assisted selection (MAS) is a blooming technology in poultry breeding programme to choose the superior individual. In order to achieve the better production level in poultry MAS can be performed rather than conventional method of selection. Commonly used markers include, Single Nucleotide Polymorphism (SNP) and Microsatellite marker etc. Obtained results 1996 Int.J.Curr.Microbiol.App.Sci (2020) 9(4): 1996-1999 based on these polymorphisms are compared with phenotypic variation among the individual birds. Various methods viz., Polymerase Chain Reaction–Restriction Fragment Length Polymorphism (PCRRFLP), Single Strand Conformation Polymorphism (SSCP) and Microsatellite marker analysis are used to identify the polymorphic patterns of genes and to identify the markers. It has been reported that prolactin gene has a crucial role on production traits like age at sexual maturity, egg weight and egg number. The main objective of the present study was recognition of single nucleotide polymorphism C-2161G in promoter region of prolactin gene in „N‟ White Leghorn and its interrelation with production traits. Materials and Methods Experimental birds A total of 200 birds each belonging to „N‟ strain of White Leghorn (IWN) which had undergone 28 generations of continuous selection were randomly selected from All India Research Co-ordinated Project (AICRP) farm on poultry improvement, Mannuthy. Collection of blood samples From each bird, 0.5-1 ml of blood was collected from the wing vein using 2.5 ml disposable syringe in a EDTA vial under aseptic condition. The samples were brought to the laboratory at 4ºC in ice pack. Isolation of genomic DNA Isolation of Genomic DNA was done from the whole blood according to the standard procedure using ODP304 Origin Genomic DNA isolation kit. The yield and quality of the DNA obtained was checked by 0.8% agarose gel electrophoresis as well as by Nano-drop spectrophotometer. The DNA samples showing the OD260/OD280 value between 1.7 and 1.9 was used for further investigation. PCR assay Polymerase chain reaction was carried out using specific set of forward (F5‟AGAGGCAGCCCAGGCATTTTAC3‟) and reverse primer(R-5‟CCTGGGTCTG GTTTGGAAATTG3‟) to amplify the 439bp fragment of prolactin gene containing single nucleotide polymorphism C-2161G in promoter region. Each diluted primer (10 pM/µl) was added to the template DNA [working solutions prepared from stock solution by diluting with sterile distilled water (Millipore) to get a final concentration of 100 ng/µL] and 2X PCR Smart Mix (origin) in a PCR tube and made upto the final volume of 20 µL using ultra-filtered Millipore water. PCR was done in Bio-Rad thermal cycler and standardization was done for each reaction by mild adjustment of concentration of ingredients and annealing temperature with the following profile: initial denaturation of 5 min at 94°C; 35 cycles of 94°C for 30 s, annealing at 67.7°C for 30 s, and 72°C for 30 s with a final elongation of 5 min at 72°C. PCR amplicon was subjected to 2% agarose gel. PCR-RFLP assay Five micro litre of the amplified product of promoter region of prolactin gene C2161Gwas added with 5 units of CsP6Irestriction enzyme and incubated at 370C for 1hr. The composition of reaction mixture with the final volume of 12μl contains 5μl PCR product, 1.2μl of 10X buffer, 0.5μl of CsP6I (10U/μl) and 5.3μl of distilled water. Restriction digestion was 1997 Int.J.Curr.Microbiol.App.Sci (2020) 9(4): 1996-1999 carried out for all the PCR amplicons. After restriction digestion, the digested PCR products were separated by electrophoresis in 3% agarose gel in 1X buffer with 50 bp DNA size marker. The restriction pattern was visualized under UV trans-illuminator and documented in gel documentation system. PCR amplicons were sequenced using respective forward and reverse primers in an automated sequencer using Sanger‟s dideoxy chain termination method at AgriGenome Labs Pvt. Ltd., Cochin. According to the polymorphic pattern birds were categorized in to three different genotypes. Genotypes and allelic frequency was calculated. The production traits viz., age at sexual maturity, egg weight at 28th,32nd and 40th weeks of age and egg number up to 40 weeks of age were measured in the randomly selected birds of „N‟ strain of White Leghorn and their association with SNP of prolactin gene was analyzed by one way ANOVA using the software SPSS (Version 21.0). Results and Discussion Lane 1 to 8: 439bp uncut fragment of CC genotype Lane 9: 50bp Ladder SNP at C-2161G position of the promoter region of prolactin gene was produced an uncut 439bp fragment represents CC genotype (Figure 1). All the 200 birds of White Leghorn were observed with the same genotype CC. The genotypic frequency of CC, CG and GG of C-2161G site were1.000, 0.000 and 0.000, respectively and the allelic frequency of C and G were 1.000 and 0.000, respectively in White Leghorn. The phenotypic performance viz., age at sexual maturity, egg weight at 28th, 32nd and 40th weeks and egg number up to 40 weeks of age of all the birds were found to be at the same level. All the birds were represented the same genotype and phenotypic performance. Hence, it has not been taken up for further association study. Figure.1 PCR-RFLP analysis of promoter region (C-2161G) of prolactin gene on 3% agarose gel (CsP6I) This result suggests that all the birds with same genotype and phenotypic performance is mainly because of the intense selection of breeding for past 30 years in AICRP on Poultry improvement, Mannuthy. It indicates the level of selection efficiency of the AICRP form. This SNP C-2161G of promoter region of prolactin gene can be used as a molecular 1998 Int.J.Curr.Microbiol.App.Sci (2020) 9(4): 1996-1999 marker to determine the efficiency of selection in a particular population. Further research study could be performed in other breeds of chicken to find out the interrelation of this SNP C-2161G with production traits. References Abdi, M., Seyedabadi, H. andGorbani, A. 2014. Prolactin and NPY gene polymorphism and its associations with production and reproductive traits in West-Azarbaijan Native chicken. Bull. Environmental Pharmacology. Life Science. 3: 39-45. Cui, J.X., Du, H.L., Liang, Y., Deng, X.M., Li, N. and Zhang, X.Q. 2006. Association of polymorphisms in the promoter region of chicken prolactin with egg production. Poultry Science. 85: 26-31. Enwright, J.F., Kawecki-Crook, M.A., Voss, T.C., Schaufele, F. andDay, R.N. 2003. A Pit-1 homeodomain mutant blocks the intranuclear recruitment of the CCAAT/enhancer binding protein α required for prolactin gene transcription. Molecular Endocrinology.17: 209-222. Jiang, R.S., Zhang, L.L., Geng, Z.Y., Yang, T. and Zhang, S.S. 2009. Single nucleotide polymorphisms in the 5´flanking region of the prolactin gene and the association with reproduction traits in geese. S. African. Journal of Animal Science. 39: 83-87. Kulibaba, R.A. 2015. Polymorphism of growth hormone, growth hormone receptor, prolactin and prolactin receptor genes in connection with egg production in Poltava clay chicken. Agriculture. Biology. 50:198207. Liang, Y., Cui, J., Yang, G., Leung, F.C. and Zhang, X. 2006. Polymorphisms of 5′ flanking region of chicken prolactin gene. Domest. Animal Endocrinology. 30:1-16. Lotfi, E., Zerehdaran, S., Ahani, M. andDehnavi, E. 2013. Genetic polymorphism in prolactin gene and its association with reproductive traits in Japanese quail (Coturnix japonica). Poultry Science Journal. 1:79-85. Rashidi, H., Rahimi-Mianji, G., Farhadi, A., and Gholizadeh, M. 2012. Association of prolactin and prolactin receptor gene polymorphisms with economic traits in breeder hens of indigenous chickens of Mazandaran province. Iranian Journal of Biotechnology. 10:129-135. Tempfli, K., Konrad, S., Gaal, K.K. and Papp, A.B. 2012. PRLR and PRL polymorphism studies in Mangalica pig and Hungarian yellow chicken. In: Proceedings of International Scientific Conference on Sustainable Development & Ecological Footprint: 26th to 27th March, 2012, Sopron, Hungary. pp. 1-6. Yousefi, S., Raoufi, Z. and Rasouli, Z. 2012. Investigation of prolactin gene polymorphism in Japanese quail. Iranian Journal of Biotechnology. 45: 289-292. How to cite this article: Azhaguraja Manoharan, S. Sankaralingam, P. Anitha, Binoj Chacko and Aravindakshan, T. V. 2020. Single Nucleotide Polymorphism C-2161G in Promoter Region of Prolactin Gene in „N‟ Strain of White Leghorn. Int.J.Curr.Microbiol.App.Sci. 9(04): 1996-1999. doi: https://doi.org/10.20546/ijcmas.2020.904.239 1999