Phân biệt thịt bò, trâu, heo bằng kỹ thuật Multiplex Realtime PCR

pdf
Số trang Phân biệt thịt bò, trâu, heo bằng kỹ thuật Multiplex Realtime PCR 8 Cỡ tệp Phân biệt thịt bò, trâu, heo bằng kỹ thuật Multiplex Realtime PCR 401 KB Lượt tải Phân biệt thịt bò, trâu, heo bằng kỹ thuật Multiplex Realtime PCR 0 Lượt đọc Phân biệt thịt bò, trâu, heo bằng kỹ thuật Multiplex Realtime PCR 38
Đánh giá Phân biệt thịt bò, trâu, heo bằng kỹ thuật Multiplex Realtime PCR
4.9 ( 21 lượt)
Nhấn vào bên dưới để tải tài liệu
Để tải xuống xem đầy đủ hãy nhấn vào bên trên
Chủ đề liên quan

Tài liệu tương tự

Nội dung

PHÂN BIỆT THỊT BÒ, TRÂU, HEO BẰNG KỸ THUẬT MULTIPLEX REALTIME PCR A MULTIPLEX REALTIME PCR METHOD TO DISCRIMINATE MEAT OF BEEF, BUFFALO AND PORK Trần Minh Tấn1,*, Nguyễn Ngọc Tuân2,** 1 2 Chi cục Thú y vùng VI tại TP HCM GV thỉnh giảng Bộ môn Thú y, Viện Khoa học Ứng dụng, trường ĐH Công nghệ TP HCM Email: *tranminhtan06@gmail.com, **nntttd@gmail.com TÓM TẮT Mục tiêu của nghiên cứu là tối ưu quy trình multiplex realtime PCR nhận diện DNA bò, trâu, heo, từ đó ứng dụng để phát hiện gian lận thương mại. Quy trình tối ưu có nồng độ mồi 200 nM và đoạn dò 100 nM (bò và trâu), nồng độ mồi 300 nM và đoạn dò 150 nM (heo); chu trình nhiệt 500C/2 phút, 950C/2 phút, 45 chu kỳ gồm biến tính ở 950C/15 giây và bắt cặp – kéo dài ở 600C/40 giây. Quy trình có độ nhạy và độ đặc hiệu cao, giới hạn phát hiện của phương pháp đối với hỗn hợp mẫu thịt tươi và thịt đã xử lý nhiệt (801200C/15 phút) là 0,1% theo khối lượng hoặc 0,005 ng DNA/phản ứng. Áp dụng quy trình để kiểm tra sản phẩm thịt chế biến trên thị trường đã phát hiện sự gian lận. Kết quả sơ bộ cho thấy 66,67% (8/12) mẫu xúc xích bò chứa thịt trâu trong sản phẩm. Tất cả 12 mẫu bò viên được kiểm tra đều phát hiện DNA bò nhưng 66,67% mẫu lẫn thịt trâu và 16,67% mẫu lẫn thịt heo. Từ khóa: DNA, multiplex realtime PCR, gian lận, thịt bò-trâu-heo. 1. ĐẶT VẤN ĐỀ Xác định loài trong sản phẩm thịt là một lĩnh vực được phát triển nhanh chóng do có liên quan đến tôn giáo, gian lận thương mại và sức khỏe người tiêu dùng. Trên thị trường, nhiều sản phẩm thịt tươi và sản phẩm thịt chế biến không ghi đúng nhãn hiệu, thành phần các loại thịt nhằm gian lận, lừa dối người tiêu dùng để thu lợi bất chính. Theo các báo cáo trước đây, khoảng 22% thịt và sản phẩm thịt chế biến ở Thổ Nhĩ Kỳ chứa loại thịt không được ghi trên nhãn [1]. Tại Thổ Nhĩ Kỳ, mẫu xúc xích với nhãn ghi 5% thịt bò lại không phát hiện DNA bò trong sản phẩm và thịt bò viên ghi nhãn là thịt bò 100% lại phát hiện được thịt gà và gà tây [10]. Tháng 07/2016, Trung tâm giám định pháp y (Sở Y tế TP. HCM) thông báo kết quả giám định bò viên của một công ty tại TP HCM cho thấy mẫu bò viên nhãn hiệu GoGo chỉ có DNA cá, không tìm thấy DNA bò, và mẫu bò viên nhãn hiệu Merlion chỉ có DNA trâu và cá nhưng không có DNA bò [9]. Như vậy, thịt bò và sản phẩm từ thịt bò có giá trị kinh tế cao đã được làm giả từ thịt trâu, thịt heo hoặc cá nhằm thu lợi bất chính. Hiện nay, Việt Nam cũng như một số nước không cho phép nhập bột thịt xương có nguồn gốc từ bò, cừu ở các nước và vùng lãnh thổ bị bệnh BSE để làm nguyên liệu sản xuất thức ăn gia súc. 1020 Ngày nay, có nhiều phương pháp phân biệt các loại thịt và sản phẩm chế biến từ thịt. Phương pháp phát hiện dựa vào protein như điện di, miễn dịch, sắc ký. Nhược điểm là cho kết quả chậm hoặc không thể áp dụng với sản phẩm thịt đã xử lý nhiệt độ cao. Phương pháp dựa vào DNA được sử dụng nhiều hơn như khuếch đại ngẫu nhiên đa hình DNA-RAPD, PCR đặc trưng cho loài. Theo đó một số công trình đã được công bố như Matsunaga và ctv [5] sử dụng kỹ thuật multiplex PCR để phát hiện sáu loại thịt bò-heo-cừudê-ngựa-gà từ hỗn hợp thịt tươi và thịt chế biến nhưng không thể phân biệt thịt trâu và bò. Cho nên Đoàn Thị Tuyết Lê và Nguyễn Ngọc Tuân [2] đã thiết kế mồi và xây dựng quy trình PCR để khẳng định trong hỗn hợp thịt bò có lẫn thịt trâu hay không. Kỹ thuật multiplex PCR cho phép phát hiện nhiều gene đích của nhiều loài khác nhau trong cùng một sản phẩm thịt. Để tăng độ tin cậy của phản ứng bằng việc sử dụng các đoạn dò (probe) đặc hiệu và rút ngắn thời gian thu kết quả, kỹ thuật multiplex realtime PCR đã được áp dụng như Rentsch và ctv [8] phát hiện DNA bò, dê, cừu, trâu trong sữa và phô mai.. Mục tiêu của bài báo là tối ưu hóa quy trình multiplex realtime PCR nhận diện DNA bò, trâu, heo trong điều kiện hiện tại của một phòng thí nghiệm, từ đó ứng dụng quy trình để phân biệt nhanh loại thịt trong sản phẩm chế biến từ thịt bò, heo, trâu. 2. VẬT LIỆU VÀ PHƢƠNG PHÁP 2.1. Chuẩn bị mẫu Hai mươi bốn mẫu thịt tươi (bò, heo, trâu) được thu thập từ một số lò mổ và mẫu thịt kiểm dịch nhập khẩu tại TP Hồ Chí Minh. Mẫu được bảo quản lạnh đông -20oC đến khi tiến hành thử nghiệm. Mỗi mẫu thịt tươi được lấy khoảng 100 gam cho vào túi nylon sạch, dán nhãn riêng. Ba mươi mẫu thịt từ 15 loài động vật và thủy sản khác được thu thập để kiểm tra độ nhạy, độ đặc hiệu (02 mẫu mồi loài). Bao gồm nhóm thú ăn cỏ (cừu, dê, ngựa), nhóm gia cầm (gà, cút, vịt, ngan), nhóm thú ăn thịt (chó, mèo), nhóm thú gậm nhấm (thỏ, chuột) và nhóm hải sản (tôm, cá). Ngoài ra, đậu nành cũng được kiểm tra đánh giá độ nhạy, độ đặc hiệu vì đây là thành phần thường được thêm vào trong chế biến xúc xích thịt [6]. Khảo sát còn thu thập 12 mẫu xúc xích bò, mẫu 12 bò viên từ cửa hàng thực phẩm ở TP HCM để kiểm tra thành phần thịt ghi trên nhãn.. 2.2. Chiết tách DNA Cân 25 mg mẫu để tách chiết DNA bằng bộ kít DNeasy blood and tissue (Qiagen, Đức). Độ tinh sạch DNA được kiểm tra bằng cách đo mật độ quang (OD) ở bước sóng 260 nm và 280 nm bằng máy quang phổ (Nanodrop 2000). Nồng độ DNA tổng số (ng/µl) được ước lượng theo công thức: OD260 x 50 x độ pha loãng. 2.3. Đoạn mồi và đoạn dò Bảng 1. Trình tự đoạn mồi và đoạn dò Ký hiệu mồi Trình tự mồi (5'– 3') Nồng độ (nM) Mồi xuôi bò F AGTTAGAGATTGAGAGCCATATACTCTCC 200 Mồi ngược bò R TTGATAAGATCATTGTCAGTCATGTTG 200 Đoạn dò bò P FAM-TGGTGACATGCCGCAACTAGACACGBHQ1 100 1021 Tham khảo [4] Trình tự mồi (5'– 3') Ký hiệu mồi Nồng độ (nM) Mồi xuôi heo F CGAGAGGCTGCCGTAAAGG 300 Mồi ngược heo R TGCAAGGAACACGGCTAAGTG 300 Đoạn dò heo P HEX-TCTGACGTGACTCCCCGACCTGG-BHQ2 150 Mồi xuôi trâu F TCTGGGGAGGATTCTCAGTAG 200 Mồi ngược trâu F AAGTGCTGCGATAATGAATGG 200 Đoạn dò trâu P ROX-AGCAACCCTCACCCGATTCTTCGC-BHQ1 100 Tham khảo [3] [8] 2.4. Quy trình multiplex realtime PCR Mỗi phản ứng gồm 5 µl DNA, 20 µl PCR chứa mastermix, và nồng độ mồi đã được tối ưu hóa (Bảng 1). Sử dụng bộ kít Platinum® Quantitative PCR SuperMix-UDG (Invitrogen, Cat.No 11730-017). Phản ứng realtime PCR được thực hiện bằng máy Agilent Stratagene Mx 3005P Systems, ở 500C/2 phút, 950C/2 phút, 45 chu kỳ biến tính ở 950C/15 giây và bắt cặp – kéo dài ở 600C/40 giây, là quy trình nhiệt đã được tối ưu hóa. Tối ưu hóa phản ứng simplex để khẳng định nồng độ primer và quy trình nhiệt thích hợp cho mỗi loài ở điều kiện phòng thí nghiệm này. DNA mỗi loài được pha loãng bậc 10 từ mẫu gốc để chạy đường chuẩn. Có hai thông số thể hiện tính ổn định của đường chuẩn [7]. Một là hệ số tương quan R2, đánh giá độ chính xác thao tác lấy mẫu có đúng thể tích mong muốn hay không. Trị số R2 phải đạt trên hoặc bằng (≥) 0,99. Điều đó có nghĩa là đường biểu diễn chuẩn phải đạt mức tuyến tính cao. Hai là hiệu quả PCR được gọi là E% (PCR efficiency). PCR đạt hiệu quả lý tưởng là cứ sau mỗi chu kỳ cường độ huỳnh quang trong một ống phản ứng phải tăng gấp đôi. Hai ống phản ứng có số lượng DNA đích ban đầu cách nhau hệ số pha loãng A, thì hai đường biểu diễn khuếch đại sẽ cách nhau n chu kỳ với cường độ huỳnh quang của hai ống sẽ cách nhau một hệ số pha loãng A = 2n. Hiệu quả PCR chấp nhận khi E% khoảng 90% đến 110%. Với công thức E% = (E-1) x 100%; E = 10-1/slope, với slope là độ dốc đường chuẩn, đường biểu diễn chuẩn lý tưởng khi độ dốc bằng -3,32. Độ dốc này được phép dao động khoảng -3,58 đến -3,1. 2.5. Độ đặc hiệu, độ nhạy Mẫu thịt bò đối chứng dương được lấy từ bò ta vàng nuôi trong nước, bò Úc, Nhật,… Thịt trâu được lấy từ trâu trong nước và trâu Ấn Độ. Thịt heo được lấy từ giống heo ngoại lai và thịt nhập khẩu. Mẫu âm tính được lấy từ loài khác như mẫu thịt cừu, dê, ngựa, gà, cút, vịt, ngan, chó, mèo, thỏ, chuột, tôm, cá tra, cá ngừ và bột đậu nành. Độ nhạy là tỷ số giữa số mẫu phát hiện dương tính trên tổng số mẫu dương tính thật sự. Độ đặc hiệu là tỷ số giữa số mẫu âm trên tổng số mẫu âm tính thật sự. 2.6. Giới hạn phát hiện (LOD) Để xác định giới hạn phát hiện của phương pháp, DNA tách chiết được pha loãng bậc 10 với nồng độ giảm dần từ 10 ng/µl đến 0,0001 ng/µl. Sau đó, chạy phản ứng multiplex realtime PCR để xác định nồng độ thấp nhất có thể phát hiện được DNA của bò, trâu và heo. 2.7. Xử lý số liệu: Số liệu đƣợc xử lý bằng Excel 1022 3. KẾT QUẢ VÀ THẢO LUẬN 3.1. Tách chiết DNA Tất cả 56 mẫu được tách chiết DNA. Nồng độ DNA thu được từ 40,6 - 94,6 ng/µl và tỷ số OD260/OD280 nằm trong khoảng 1,8 - 2,0. Như vậy DNA đã được tinh sạch tốt, sẵn sàng sử dụng cho phản ứng realtime PCR. 3.2. Quy trình multiplex realtime PCR Hệ số tương quan R2 đối với DNA bò là 0,992, heo là 0,990, và trâu là 0,995 (Hình 1). Các hệ số tương quan này hoàn toàn phù hợp trong giới hạn (R2 ≥ 0,99). Như vậy các giá trị Ct tại những điểm pha loãng bậc 10 có độ tuyến tính cao. Thao tác pha loãng mẫu, thao tác pipet hút đúng lượng thể tích cần sử dụng. Một tiêu chí khác để đánh giá phản ứng realtime PCR là hiệu quả phản ứng PCR (E%). Giới hạn cho phép của E% trong khoảng 90 - 110%. Kết quả khảo sát cho thấy giá trị E% đạt được trong phản ứng realtime PCR đa mồi từ 96,2 - 104,3% (Hình 1) nằm trong giới hạn cho phép. Độ dốc (slope) từ -3,417 đến - 3,222 là phù hợp với khoảng giới hạn cho phép (-3,58 đến -3,10). Hình 1. Đường khuếch đại của DNA bò (a), heo (b) và trâu (c). Đường chuẩn bò, heo, trâu (d) 3.3. Độ nhạy, độ đặc hiệu Độ đặc hiệu của phản ứng được đánh giá trên mẫu thịt của 3 loài mục tiêu và những loài khác. Tổng số mẫu thực hiện là 56 mẫu. Trong đó có 8 mẫu bò, 8 mẫu heo, 8 mẫu trâu và 30 mẫu của 15 loài khác gồm cừu, dê, ngựa, gà, cút, vịt, ngan, chó, mèo, thỏ, chuột, tôm, cá tra, cá ngừ và 2 mẫu đậu nành. Tín hiệu huỳnh quang màu FAM chỉ được ghi nhận trên những mẫu có nguồn gốc từ bò. Những mẫu có nguồn gốc từ heo, trâu và các loài khác không ghi nhận được tín hiệu màu FAM của bò. Tương tự, màu HEX chỉ được ghi nhận trên những mẫu có nguồn gốc từ heo và màu ROX chỉ được ghi nhận trên những mẫu có nguồn gốc từ trâu. Các mẫu bò, heo, trâu đều được phát hiện trong cùng một phản ứng multiplex realtime và không có phản ứng chéo giữa các loài khác nhau. Độ nhạy và độ đặc hiệu của phản ứng đều đạt 100% đối với bò, heo và trâu. 1023 3.4. Giới hạn phát hiện của DNA Giá trị Ct và độ lệch chuẩn tương đối (relative standard deviation: RSD) được thể hiện trong Bảng 2. Giá trị RSD biến thiên thấp cho thấy phản ứng multiplex realtime PCR có tính ổn định cao ở các nồng độ DNA khác nhau và ở những lần chạy kiểm tra khác nhau. Tại nồng độ 0,005 ng/µl, giá trị Ct trung bình của mẫu DNA bò là 36,72 ± 0,240. Ct mẫu heo và trâu ở nồng độ này lần lượt 37,75 ± 0,125 và 37,71 ± 0,100. Ở nồng độ pha loãng tiếp theo sau đó cho kết quả âm tính với cả ba loài vì không ghi nhận được tín hiệu huỳnh quang, RSD ở tất cả nồng độ pha loãng này có giá trị nhỏ hơn 1,0 (0,08 – 0,886). Như vậy giới hạn phát hiện DNA của quy trình là 0,005 ng/phản ứng. Theo Koppel và ctv [4], giới hạn phát hiện DNA của hỗn hợp sữa bò, trứng gà, hạt vừng, hạt hạnh nhân là 0,0032 ng DNA/phản ứng (nền mẫu là DNA tinh dịch cá trích), và 0,32 ng DNA thịt heo [3], và 0,32 ng DNA thịt trâu hoặc thịt bò (nền mẫu là DNA tinh dịch cá trích) [8]. Bảng 2. Giá trị Ct khi pha loãng bậc 10 DNA của thịt bò, heo, trâu DNA Bò Heo Trâu (ng) Trung bình SD RSD Trung bình SD RSD Trung bình SD RSD 50 22,30 0,155 0,695 23,58 0,204 0,858 23,65 0,045 0,191 5 26,23 0,197 0,750 27,59 0,243 0,871 27,21 0,241 0,886 0,5 29,85 0,046 0,155 31,21 0,102 0,326 30,93 0,052 0,168 0,05 33,32 0,205 0,615 33,96 0,029 0,085 34,12 0,095 0,279 0,005 36,72 0,240 0,654 37,84 0,125 0,331 37,71 0,100 0,265 0,0005 - - - 3.5. Ứng dụng giới hạn phát hiện trong hỗn hợp thịt tƣơi và thịt xử lý nhiệt Trong thí nghiệm này, thịt gà được sử dụng làm nền mẫu để thêm các loại thịt bò, heo, trâu tạo thành hỗn hợp có tỷ lệ khác nhau, giảm dần từ 32,0% đến 0,1%. Sở dĩ chọn tỷ lệ phối trộn thấp nhất là 0,1% vì trong gian lận thương mại nếu dưới mức tỷ lệ này sẽ không đem lại hiệu quả kinh tế, giá thành sản phẩm giảm không đáng kể. Hỗn hợp thịt tươi này được chia thành các phần bằng nhau giữa thịt tươi, và thịt xử lý trong 15 phút ở 800C hoặc 1200C. Kết quả trình bày trong Bảng 3 cho thấy không có sự chênh lệch nhiều về giá trị Ct giữa mẫu đã xử lý nhiệt và mẫu thịt tươi. Và ở tỷ lệ 0,1% về khối lượng, giá trị Ct của mẫu thịt tươi và thịt đã xử lý nhiệt nằm trong khoảng 29,02 đến 34,61. Như vậy bò, heo, trâu đều được phát hiện ở mức 0,1% khối lượng trong hỗn hợp thịt tươi và thịt xử lý nhiệt. Bảng 3. Giá trị Ct của hỗn hợp thịt tươi và thịt xử lý nhiệt Bò Heo Trâu Tỷ lệ (%) Thịt tươi 800C /15' 1210C /15' Thịt tươi 800C /15' 1210C /15' Thịt tươi 800C /15' 1210C /15' 32 20,10 21,30 21,59 22,83 22,51 22,45 19,98 20,33 19,56 10 21,61 23,59 22,88 24,86 24,44 23,60 22,20 22,68 21,85 3,2 23,48 24,99 24,77 26,93 27,13 26,53 23,74 24,29 22,98 1 25,45 27,68 26,91 29,44 29,49 28,83 25,50 27,30 23,51 0,32 27,4 29,13 29,38 32,71 31,01 30,99 26,92 27,89 25,72 0,1 29,02 31,25 31,60 34,32 33,96 34,61 28,99 30,13 29,11 1024 3.6. Ứng dụng kiểm tra một số mẫu thịt chế biến lƣu hành trên thị trƣờng 3.6.1. Mẫu xúc xích Trong 12 mẫu được kiểm tra, tất cả đều phát hiện được thành phần heo như công bố trên bao bì của nhà sản xuất (Bảng 4). Tuy nhiên, thịt trâu đã được phát hiện tất cả 8 mẫu của công ty A và B. Đó là thành phần thịt mà 2 công ty đều không công bố trong nhãn sản phẩm. Thịt trâu có thể được thêm để tăng giá trị dinh dưỡng cũng như hương vị của sản phẩm. Mặt khác, giá trị kinh tế của trâu thấp hơn bò. Cho nên việc thêm thịt trâu vào xúc xích bò hoặc xúc xích bò heo để giảm giá thành sản xuất, tăng lợi nhuận. 3.6.2. Mẫu bò viên Thịt viên sau khi xay nhỏ, chế biến, tẩm ướp gia vị khó có thể nhận biết được thành phần bằng cảm quan. Mười hai (12) mẫu bò viên từ 06 công ty được chọn kiểm tra. Kết quả ở Bảng 7 cho thấy tất cả 12 mẫu đều được phát hiện thịt bò trong sản phẩm. Tuy nhiên, hai mẫu bò viên công ty A đã phát hiện thêm thịt trâu. Đối với công ty B, heo và trâu không có trên nhãn nhưng được phát hiện bằng multiplex realtime PCR. Tương tự, những mẫu của công ty D và E đã phát hiện được thịt trâu trong sản phẩm. Như vậy, chỉ có 04 trên 12 mẫu đúng về thành phần bò, heo công bố trên nhãn sản phẩm. Hai trong số 12 mẫu (16,67%) hiện diện thêm thịt heo mà không được ghi trên nhãn; có 08 trên 12 mẫu (66,67%) được thêm thịt trâu vào trong sản phẩm bò viên. Bảng 4. Kết quả kiểm tra mẫu xúc xích 1025 X TP trên nhãn Bò Heo Trâu A heo, gà - 21,35 19,63 A bò, heo 21,31 22,79 18,47 A heo, tôm - 17,71 16,56 A heo, tôm - 17,36 17,82 B gà, heo, ĐN - 23,32 20,46 B gà, heo, ĐN - 19,24 21,51 B bò, heo, gà 24,05 26,68 20,97 B bò, heo, gà 22,85 21,62 20,76 C heo, gà - 19,33 - C heo, gà, ĐN - 20,04 - C bò, heo, gà, cá 18,33 22,17 - C bò, heo, cá 19,01 23,08 - Bảng 5. Kết quả kiểm tra mẫu bò viên X TP trên nhãn Bò Heo Trâu A bò, cá basa 20,33 - 18,48 A bò, cá basa 17,95 - 16,51 B bò, đậu nành 23,15 22,36 18,99 B bò, đậu nành 22,15 19,38 18,72 C bò, cá, gà 22,1 - - C bò, cá, gà 23,46 - - D bò, mỡ heo 20,06 24,36 17,75 D bò, mỡ heo 17,44 19,16 16,36 E bò, heo, gà 21,16 20,03 18,91 E bò, heo, gà 20,59 20,57 19,05 F bò, thịt heo 20,16 22,03 - F bò, thịt heo 21,08 22,78 - Ghi chú: X = Cty, ĐN = đậu nành. 4. KẾT LUẬN Đã tối ưu hóa quy trình multiplex realtime PCR phân biệt thịt bò, trâu, heo với độ đặc hiệu và độ tin cậy cao, giới hạn phát hiện thịt tươi (bò, trâu, heo) và thịt xử lý nhiệt (80-1200C/15 phút) là 0,1% theo khối lượng trong hỗn hợp hoặc 0,005 ng DNA/phản ứng. Ứng dụng multiplex realtime PCR để phát một số sản phẩm thịt chế biến trên thị trường cho thấy có vấn đề gian lận giả thịt bò từ thịt heo và thịt trâu. TÀI LIỆU THAM KHẢO [1] Ayaz Y, Ayaz N and Erol I (2006). Detection of species in meat and meat products using enzymelinked immunosorbent assay. Journal of Muscle Foods 17: 214-220. [2] Đoàn Thị Tuyết Lê và Nguyễn Ngọc Tuân (2011). Phân biệt thịt trâu và bò bằng kỹ thuật PCR. Tạp chí Nông nghiệp và Phát triển nông thôn, số 8 trang 71-77. [3] Koppel R, Ruf J, Zimmerli F, Breitenmoser A (2008). Multiplex realtime PCR for the detection and quantification of DNA from beef, pork, chicken and turkey. European Food Reseach and Technology 227: 1199-1203. [4] Koppel R, Ruf J, Rentsch J (2010). Multiplex realtime PCR for the detection and quantification of DNA from beef, pork, horse and sheep. European Food Research and Technology 232: 151-155. [5] Matsunaga T, Chikuni K, Tanae R, Muroya S, Shibata K, Yamad J, Shinmura Y (1999). A quick and simple method for the identification of meat species and meat product by PCR assay. Meat Science 51:143-148. [6] Nguyễn Ngọc Tuân (1998). Thay thế đậu nành ly trích 82% protein bằng bột đậu nành Việt Nam trong chế biến xúc xích cá. Tập san KHKT Nông Lâm Nghiệp, số 12, trang 89-90. 1026 [7] Phạm Hùng Vân (2009). PCR và realtime PCR, Các vấn đề cơ bản và các ứng dụng thường gặp. Nhà xuất bản Y học, TP Hồ Chí Minh, 34-70. [8] Rentsch J, Weibel S, Ruf J, Eugster A, Beck K & Koppel R (2013). Interlaboratory validation of two multiplex quantitative realtime PCR methods to determine species DNA of cow, sheep and goat as a measure of milk proportions in cheese. European Food Research and Technology 236: 217227. [9] Trung tâm tin tức VTV24 (2016). http://vtv.vn/chuyen-dong-24h/khong-tim-thay-ADN-cua- botrong-2-mau-bo-vien-cua-viet-sin-20160712193338002.htm. [10] Ulca P, Balta H, Cagin I and Senyuva H Z (2013). Meat species identification and Halal authentication using PCR analysis of raw and cooked traditional Turkish foods. Meat Science 94: 280-284. 1027
This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.
Back to Top