Nội dung

Turkish Journal of Botany Turk J Bot (2015) 39: 988-995 © TÜBİTAK doi:10.3906/bot-1502-40 http://journals.tubitak.gov.tr/botany/ Research Article Overexpression of a soybean expansin gene, GmEXP1, improves drought tolerance in transgenic tobacco 1 2 3 2 2 3, Thanh Son LO , Hoang Duc LE , Vu Thanh Thanh NGUYEN , Hoang Ha CHU , Van Son LE , Hoang Mau CHU * 1 Tay Bac University, Son La, Vietnam 2 Institute of Biotechnology, Vietnam Academy of Science and Technology, Hanoi, Vietnam 3 Department of Genetics and Modern Biology, Thai Nguyen University, Thai Nguyen, Vietnam Received: 19.02.2015 Accepted/Published Online: 06.10.2015 Printed: 21.12.2015 Abstract: The EXP1 gene encodes expansin, which has the ability to loosen the plant cell wall. The soybean expansin gene GmEXP1 is activated specifically during the root elongation process, and thus it plays important roles in root development. During the drought period, changes in pressure within the cell and the fast development of the root allow plants to collect water from deep soil, which in turn helps plants grow and develop. In this study, we have successfully cloned and generated a GmEXP1 construct expressing recombinant expansin protein in tobacco plants. GmEXP1 is expressed in transgenic tobacco plants and passed on to the next generation. The transgenic tobacco plants have improved drought tolerance, which is demonstrated in both the length and volume of roots. From these promising results, we applied the same approach to generate drought-tolerant plants. Key words: Agrobacterium-mediated transformation, expansin, GmEXP1 gene, loosening of cell wall, root elongation, soybean 1. Introduction Drought stress is one of the most important yield-reducing factors in crop production. The molecular basis of drought tolerance mechanisms in plants have attracted interest: one study aimed to identify the protein profiles and dehydrin accumulation in seven varieties of local Indonesian soybeans (Arumingtyas et al., 2013). The root is an important part of the plant. It is the main water absorber and distributer to cells so that it can be distributed throughout the plant. During drought periods, plants with long, spread out roots can collect water and nutrients and thus have a better chance to survive (Huck et al., 1983). The development of plant roots depends on genes that control morphological characteristics, growth, development, metabolism, and other physiological processes (Taylor et al., 1978; Wang et al., 2010; Uga et al., 2013; Xu et al., 2014). In a study by Makbul et al. (2011), anatomical changes in the root, stem, and leaf of soybean (Glycine max) plants under drought stress were studied by light microscope and their significance was evaluated by numerical analysis. In soybean, expansin protein is found at the growth domain of the main root and side roots. Expansins are required for root elongation (McQueenMason et al., 1994; Choi et al., 2003; Lee et al., 2003). All 4 groups of expansin, α-expansin (EXPA), β-expansin (EXPB), expansin-like A (EXLA), and * Correspondence: chuhoangmau@tnu.edu.vn 988 expansin-like B (EXLB), have the ability to loosen plant cell walls. These proteins are encoded by a multigene family and are found in many plants such as rice, wheat, soybean, corn, and potatoes (Kende et al., 2004). In soybean, there are 75 different EXP genes found on 18 chromosomes. The GmEXP1 from chromosome 17 is 1491 nucleotides long, containing 3 exons and 2 introns. The coding region is 768 nucleotides in length, encoding α-expansin with 255 amino acids (Kende et al., 2004; Zhu et al., 2014), and consists of three regions: a signaling region, an active region similar to endoglucanase, and the pollen allergen region for substrate adhesion (Wu et al., 2001). When the cell wall reaches a pH growth level of 4.5–6.0 and the ratio of expansin and cell wall (on a dry mass basis) is 1:10,000, the expansin will cause cellular structural changes by sticking, breaking links between polysaccharide components (including pectin and hemicellulose), and loosening the polymer network. Pressure from the swelling of the cell increases the distance between the microfibers in both horizontal and vertical directions (Cosgrove, 2000, 2005). In addition to the direct impact on the cell wall, expansin also indirectly creates room for cellulase enzyme to come into contact with the substrate, effectively accelerating the increase in cell size. Some experiments have shown that the activity and distribution of expansin in soybean root LO et al. / Turk J Bot cells play an important role in root elongation, enabling plants to absorb more water and nutrients from deeper soil layers (Cosgrove et al., 1998). The GmEXPB2 gene from the β-expansin group was shown to be activated under certain adverse conditions, related to root elongation, increased phosphorus absorption, and osmotic pressure changes. These are changes that are observed in response to drought condition (Guo et al., 2011, Zhou et al., 2014). In 2003, Lee et al. demonstrated the role of GmEXP1 in cell wall expansion at the developing site of the tobacco plant root. The technology used to transform A. tumefaciens has opened up the possibility to create transgenic plants carrying the GmEXP1 gene to improve root elongation for drought resistance. This work studying the expression of the GmEXP1 gene isolated from soybean cultivars aims at improving drought tolerance in transgenic tobacco. 2. Materials and methods 2.1. Materials Nine Vietnam local soybean cultivars, labeled SL1, Sl2, SL3, SL4, SL5, SL6, BK, VP, and DT84, were used for isolation and molecular cloning of the GmEXP1 gene. Among these cultivars, the local cultivar SL1, which has the most developed root system, was used as the source of GmEXP1 for transformation. The Nicotiana tabacum K326 tobacco plant was used to check activity of the recombinant vector. The DH5α E. coli strain, A. tumefaciens CV58, and some other vectors such as pBT, pRTRA7/3, and pCB301 were used for cloning, vector design, and transformation. The primers used for PCR and real time RT-PCR are shown in Table 1. 2.2. Isolation, cloning, and analysis of the GmEXP1 gene Total RNA was isolated from soybean leaves using TRIzol Reagent (Life Technologies). cDNA was synthesized using a Maxima First Strand cDNA Synthesis Kit (Thermo Scientific). The GmEXP1 gene was cloned from cDNA using the SoyEXP1-F-NcoI and SoyEXP1-R-NotI primers, then ligated into the pBT cloning vector, transformed, and expressed in E.coli DH5α. Colony PCR was used for screening. The gene was then sequenced and investigated using BioEdit and DNASTAR software. 2.3. Agrobacterium-mediated transformation Agrobacterium-mediated transformation via leaf infection and regeneration of tobacco plants was done as previously described by Topping (1998). 2.4. Real-time RT-PCR for GmEXP1 gene expression analysis in tobacco The transcription level of GmEXP1 was determined by realtime RT-PCR using SYBR Green I fluorescent dye from Roche. The process was carried out as follow: 1) Extract total RNA using TRIzol Reagent (Life Technologies). 2) Synthesize cDNA using Maxima First Strand cDNA Synthesis Kit (Thermo Scientific). 3) Perform real-time RT-PCR using Roche LightCycler 480; thermal cycle: denaturation at 95 °C for 10 min; amplification and binding for 45 cycles (95 °C for 10 s, 58 °C for 10 s, 72 °C for 20 s); analyze the flow temperature when the temperature increases from 65–95 °C for 1 min and continue to collect fluorescent signals. 4) Calculate and determine expression (R) using the R = 2–∆∆Ct method of Livak and Schmittgen (2001). Results are presented relative to those of genes encoding actin. 2.5. Analysis of recombinant expansin protein by western blot To extract total protein, 0.5 g of leaves were crushed in liquid nitrogen and dissolved in 1 mL of PBS with 0.05% Tween 20 (PBS-T), then centrifuged at 13000 rpm for 15 min. Proteins were denatured and run on 10% SDSPAGE, then transferred to nitrocellulose membranes using a Pierce G2 Fast Blotter (25 V, 1.3 mA for 20 min). Membranes were then blocked in blocking solution (5% skim milk in PBS-T) overnight and incubated with primary antibody (c-myc) for 3 h by shaking at room temperature, followed by 3 washes with PBS, and then incubated with secondary antibody for 2 h. Mouse monoclonal antibody Table 1. The primers used for PCR and real-time RT-PCR. Primers Nucleotide sequence (5’ - 3’) Size (bp) SoyEXP1FNcoI CATGCCATGGATGGGCAAAATCATGCTTGT SoyEXP1RNotI ATTTGCGGCCGCTTAGAACTGAACTGGGCTAGA 790 (cDNA) 1513 (DNA) qEXP1-F CCTATGCCTTCTCACCTTCTG qEXP1-R GCAGTTCTAGTTCCATACCCAG qAct-F GATCTTGCTGGTCGTGATCTT qAct-R GTCTCCAACTCTTGCTCATAGTC 133 152 989 LO et al. / Turk J Bot to c-myc (Santa Cruz Biotech) was diluted in 5% milk in PBS at 1:700. For secondary antibody, antimouse IgG antibody attached HRP (horse radish peroxidase) was diluted in 5% milk in PBS at 1:4000. Results were displayed using TMB (3,3’,5,5’-tetramethyl benzidine) or DAB (3,3’-diaminobenzidine tetrahydrochloride). 2.6. Evaluation of the development of transgenic roots Seeds from transgenic plants were sown on MS medium with kanamycin (50 mg/L). After forming 2 leaves, the plants were grown on pots of yellow sand to test for drought resistance. Estimation of the drought tolerance was initiated when plants had 3 or 4 true leaves; watering was stopped in the experimental plots while it was continued in the control plots, as described by Le et al. (1998). The root length, volume, and dry mass were measured after 3, 5, 7, and 9 drought days. 3. Results 3.1. Cloning of the GmEXP1 gene from Vietnamese soybean cultivars The GmEXP1 coding sequences isolated from the cDNA of 9 soybean cultivars are 99.3%–99.7% identical to sequences from GenBank (AF516879). They are 768 bp in length, encoding 255 amino acids. When compared with the classification system proposed by Zhu et al. (2014), GmEXP1 is identical to GmEXPA37, an α-expansin subfamily, which is located on chromosome 17. This result is consistent with the soybean mRNA genetic map constructed by Libault et al. (2010). The GmEXP1 cDNA sequences from soybeans were accepted by GenBank and published under the following codes: HG799004, HG799005, HG799006, HG799007, HG799008, HG799009, HG799010, LN681352, and LN681353, and the two GmEXP1 DNA sequences are LM651915 and LM651916. 3.2. Generation and analysis of transgenic tobacco plants 3.2.1. Generation of transgenic tobacco plants Of all the collected soybean cultivars, the cultivar SL1 from Phu Yen, Son La, has the longest root system, and thus we used it as the source for the GmEXP1 gene. The GmEXP1 gene (NCBI ID: HG799004) was isolated from cDNA and cloned into the pCB301 plant transgenic vector. The modified gene was designed to have the following components between the left border (LB) and right border (RB) for plant gene transfer: promoter 35S, c-myc tag, polyA, and nptII for kanamycin screening. The recombinant vector was transformed into tobacco plant K326 using A. tumefaciens CV58. PCR of GmEXP1 in the T0 generation leaves revealed that 32 of 44 transgenic tobacco lines carried this transgene. From these 32 PCR-positive transgenic tobacco lines, we determined the GmEXP1 gene activity using RT-PCR. This technique allows rapid detection of transgene activity based on mRNA production. The total RNA was extracted from leaves and was converted to cDNA using reverse transcriptase enzyme and then run on PCR using specific primers (SoyEXP1F/SoyEXP1R). The RT-PCR products were checked on a 0.8% agarose gel (Figure 1). Specific bands of approximately 0.79 kb in size appeared on lanes 26, 30, and 36 (correspond to transgenic lines 26, 30, and 36, respectively), suggesting that the GmEXP1 gene had been successfully incorporated into the tobacco genome and transcribed into mRNA in 3/32 transgenic lines. We then used these 3 transgenic lines for further analysis. 3.2.2. Germination and selection of T1 transgenic tobacco plants T0 seeds were sowed on MS medium supplemented with kanamycin for selection. We expected that the germinated and developed seeds would carry the recombinant GmEXP1 construct. The wild-type seeds were unable to grow in kanamycin medium (Figure 2). Transgenic tobacco line number 36 did not germinate in either the control or kanamycin medium. In contrast, the seeds of Figure 1. Electrophoresis of RT-PCR products to determine GmEXP1 activity from transgenic tobacco lines. M: DNA ladder, 1 kb; 24–36: RT-PCR products from transgenic tobacco lines; (+): PCR product of pCB301_GmEXP1 vector; wt: RT-PCR product from control tobacco plants. 990 LO et al. / Turk J Bot Figure 2. Tobacco seeds sown on the MS medium without antibiotic (A) and with kanamycin (B). 26, 30, 36: seeds of transgenic tobacco lines; wt: wild-type tobacco K326. Vertical bars represent standard error. transgenic lines 26 and 30 were able to germinate and develop normally in both control and kanamycin media, indicating the proper function of the ntpII gene. 3.2.3. Transcription levels of the GmEXP1 gene To assess the transcription level of the transgene GmEXP1 in transgenic tobacco plants, we performed real-time RT-PCR using primer pair qEXP1-F/qEXP1-R (Table 1). Actin expression was used for reference with primer pair qAct-F/qAct-R (Table 1). Results were evaluated using the 2–ΔΔCt method of Livak and Schmittgen (2001). 3.2.3.1. Transcription levels of GmEXP1 in T0 generation transgenic tobacco plants The transgenic tobacco plants T026, T030, and T036 were subjected to total RNA extraction and cDNA synthesis (1 µg/reaction). Real-time RT-PCR reactions allowed determination of the differences in mRNA copy number of the GmEXP1 gene and thus displayed different levels of expression in each sample. The graph shows the threshold cycles (Ct) through the actin and GmEXP1 cDNA amplification at cycles 24 and 20–22, respectively. The graph of the melting temperature and peak flow shows that the real-time RT-PCR reaction amplified two main products (actin and GmEXP1) and no other products. Among these 3 transgenic plants, T026 has the lowest expression level and T030 has the highest. Table 2 shows the relative expression levels of GmEXP1 in T0 generation plants compared to the level in T026. 3.2.3.2. Transcription levels of GmEXP1 in T1 generation transgenic tobacco plants Similar to the T0 generation, real-time RT-PCR in T1 transgenic tobacco plants displayed the same cDNA amplification curves between the control actin and GmEXP1. The graph also shows the melting temperature and flow peak at 82 °C (for GmEXP1) and 84 °C (for actin). This confirmed the existence of two amplified DNA products and no other unspecific products. The total Ct values obtained from real-time reaction were used to identify the ΔCt values, ΔΔCt, and R expression level to compare to those of T026 using the Livak method. T1 plants 26-1, 26-2, 26-3, 30-1, and 30-2 had similar expression levels to the T026 plants (Figure 3). When applying the statistical analysis t-test on expression level of transgenic plants belonging to T126 and T130 lines with α = 0.001, the results of the analysis showed that tstat = 0.077, smaller than the value tα one-sided (10.21) and tα two-sided (12.92). This shows that the two transgenic tobacco lines 26 and 30 have the same relative expression levels of the GmEXP1 gene at 99.9% reliability. Table 2. Relative GmEXP1 gene expression in transgenic tobacco plants T0 generation. Samples Ct_EXP1 Ct_Actin ΔCt(T) T036 21.75 23.90 T030 20.89 23.93 T026 21.96 23.97 ΔCt(C) ΔΔCt R/26 –2.15 –0.14 1.11 –3.04 –1.03 2.04 0.00 1.00 –2.01 991 LO et al. / Turk J Bot Figure 3. Relative expression level of GmEXP1 gene in T1 generation plants, compared to the expression level in T026. Vertical bars represent standard error. Several plants, such as 26-4, 30-3, and 30-4, had 1.32 to 1.79 times higher transgene expression level than the T026 plant. This is due to the variation in GmEXP1 expression from different plants, or influenced by other intracellular factors such as the position of the integrated gene on the chromosome, change in gene copy numbers through sexual reproduction, or change in expression efficiency of the target gene in later generations. 3.2.4. Analysis of recombinant expansin protein in transgenic tobacco plants The GmEXP1 gene is tagged with c-myc at the 3’-terminus, allowing us to determine the expression of recombinant protein using c-myc antibody. Using ExPASy tools, we predicted that the protein size is about 30 kDa. Indeed, we detected specific bands with the predicted size in the 3 T0 generation transgenic plants (Figure 4A), suggesting that the recombinant GmEXP1 gene had been successfully expressed in tobacco plants. Similarly, we examined the expression of recombinant protein in T1 generation plant lines 26 and 30, and also obtained specific bands as expected (Figure 4B). This result indicates that the GmEXP1 transgene passed from M (+) wt 26 30 the T0 to T1 generation and still expressed the recombinant expansin protein. 3.3. T1 transgenic tobacco plants showed increased drought tolerance Seeds from transgenic tobacco lines 26 and 30 were placed in kanamycin medium until 2 leaves developed, then transferred to pots of yellow sand. To investigate the biological function of GmEXP1, these T1 generation plants were placed in an artificial drought condition for 3, 5, 7, and 9 days and were compared between experimental plots and the control plots, the transgenic plants and control nontransgenic plants (Figure 5). To further investigate the role of GmEXP1 in drought tolerance, we evaluated the root development of T1 generation plants. When plants developed 4 or 5 true leaves, the root development was subjected to investigation after 3, 5, 7, and 9 days of artificial drought. The assessment criteria included the root length, volume, and dry mass (Figure 6). Root morphology varied depending on the control or drought environment. In general, over 3, 5, 7, and 9 days of drought, roots all increased in length, dry mass, and 1 36 2 3 4 5 6 7 8 wt (T0) M B A 50 kDa 35 kDa 25 kDa ~37 kDa ~30 kDa ~ 30 kDa 34 kDa 26 kDa Figure 4. Western blot for recombinant expansin protein in transgenic tobacco plants T0 (A) and T1 (B). M: Standard protein ladder (20–120 kDa); 26, 30, 36: transgenic tobacco plants; wt: wild-type tobacco plant K326; (+): protein 37 kDa with c-myc tag; 1–4: T1 transgenic tobacco plants from line T026; 5–8: T1 transgenic tobacco plants from line T030; T0: transgenic plants T026. 992 LO et al. / Turk J Bot Figure 5. Wild-type and transgenic tobacco plants under drought (A) or normal watered condition for 5 days (B). 26, 30: transgenic tobacco plants from T026 and T030, respectively; wt: wild-type tobacco plants. Vertical bars represent standard error. Figure 6. Root development (morphology, length, volume, and dry weight) in wild-type and transgenic tobacco plants compared to normal watered conditions. Vertical bars represent standard error. volume compared to the roots of plants under the control watered condition. The length of the major roots from lines 26 and 30 increased from 4.85% to 22.27% compared to the control, while those of nontransgenic plants increased only from 1.59% to 9.82% after 9 days of experiment. The dry mass of the transgenic lines increased from 4.36% to 17.41% compared to the control, while in nontransgenic plants it increased only from 2.71% to 10.63% after 9 days of the experiment. The root volume from transgenic plant lines 26 and 30 remarkably increased from 19.13% to 20.08% compared to the control at day 7; nontransgenic plants increased up to 10.32%. The root volumes of all plants decreased at day 9, possibly due to the loss of water from the cells and the entire body caused by drought. 993 LO et al. / Turk J Bot The above analysis has demonstrated the effect of the GmEXP1 transgene on the size and volume of transgenic tobacco plant roots under 3, 5, 7, and 9 days of drought. It is clear that the GmEXP1 gene from soybean genome was isolated, integrated in the tobacco genome, and inherited in the T1 generation. The recombinant protein was shown to be stably expressed and have biological function in the ability to resist drought in transgenic plants. 4. Discussion Climate change causes prolonged droughts and increased desertification in many parts of the world. This is one of the main causes of reduced productivity and quality of agricultural crops as well as shrinking farmable land. To combat these problems, it is urgently required to select and create agricultural crops that can resist and withstand adverse environmental conditions. Soybeans are relatively sensitive to external conditions and belong to the low drought tolerance group. Therefore, it is important to characterize the drought tolerance ability, as well as to study the physiological, biochemical, and molecular biological basis of drought tolerance in soybean plants, and to apply this improved ability. Traditional breeding methods have shown some results, but are very time-consuming, inefficient, and complicated and require large populations. To overcome these difficulties, advances in transgenic technology have helped to create transgenic soybean lines, which express important features such as improving drought tolerance, which has gained considerable achievements (De Ronde et al., 2004; Valente et al., 2009; Zhang et al., 2010; Li et al., 2013; De Paiva Rolla et al., 2014). A study by Lee et al. (2003) showed that the GmEXP1 gene, encoding an expansin protein, an important component in cell wall stretching, is abundant at the tip of the root and thus important for soybean root elongation. The mechanism of cell stretching by expansin proteins has been described. These proteins stick in the cell walls, breaking the link between the polysaccharides, which in turn loosens the cellulose fiber network, resulting in cell wall stretching under pressure (Cosgrove, 2000). Additionally, Guo et al. (2011) showed that the GmEXPB2 gene was successfully isolated, which also encodes an expansin protein, and transferred into Arabidopsis. These transgenic plants are capable of increasing cell division and developing roots longer than in the control plants. Li et al. (2011) examined the drought resistance of transgenic tobaccos overexpressing TaEXPB23, which were cloned from wheat. The results indicated that the transgenic tobacco lines lost water more slowly than the wild-type plants under drought stress; their cells could sustain a more integrated structure under water stress than that of the wild type. In this study, GmEXP1 isolated from the soybean cultivar SL1 was employed to design a construct expressing a recombinant expansin protein with a c-myc tag. We were able to detect the expression of the recombinant protein using the myc antibody in transgenic tobacco plants. The transgenic tobacco plants showed improved tolerance to experimental drought, indicating the potential to apply this approach to generate droughttolerant soybean plants as well as other crops. Acknowledgment The authors would like to express their gratefulness for the help of the Key Laboratory of Gene Technology, Institute of Biotechnology, Vietnam Academy of Science and Technology. References Arumingtyas EL, Savitri ES, Purwoningrahayu RD (2013). Protein profiles and dehydrin accumulation in some soybean varieties (Glycine max L. Merr) in drought stress conditions. American Journal of Plant Sciences 4: 134–141. Choi D, Lee Y, Cho HT, Kende H (2003). Regulation of expansin gene expression affects growth and development in transgenic rice plants. Plant Cell 15: 1386–1398. Cosgrove DJ (2000). Loosening of plant cell walls by expansins. Nature 407: 321–326. Cosgrove DJ (2005). Growth of the plant cell wall. Nat Rev Mol Cell Biol. 6: 850–861. Cosgrove DJ, Durachko DM, Li LC (1998). Expansins may have cryptic endoglucanase activity and can synergize the breakdown of cellulose by fungal cellulases. In: Annual Meeting of the American Society of Plant Physiologists, pp. 171–178. 994 De Paiva Rolla AA, de Fátima Corrêa Carvalho J, Fuganti-Pagliarini R, Engels C, do Rio A, Marin SR, de Oliveira MC, Beneventi MA, Marcelino-Guimarães FC, Farias JR et al. (2014). Phenotyping soybean plants transformed with rd29A:AtDREB1A for drought tolerance in the greenhouse and field. Transgenic Res 23: 75–87. De Ronde JA, Laurie RN, Caetano T, Greyling MM, Kerepesi I (2004). Comparative study between transgenic and non-transgenic soybean lines proved transgenic lines to be more drought tolerant. Euphytica 138: 123–132. Guo W, Zhao J, Li X, Qin L, Yan X, Liao H (2011). A soybean β-expansin gene GmEXPB2 intrinsically involved in root system architecture responses to abiotic stresses. Plant J 66: 541–552. Huck MG, Ishihara K, Peterson CM, Ushijima T (1983). Soybean adaptation to water stress at selected stages of growth. Plant Physiol 73: 422–427. LO et al. / Turk J Bot Kende H, Bradford K, Brummell D, Cho HT, Cosgrove D, Fleming A, Gehring C, Lee Y, McQueen-Mason S, Rose J et al. (2004). Nomenclature for members of the expansin superfamily of genes and proteins. Plant Mol Biol 55: 311–314. Taylor HM, Burnett E, Booth GD (1978). Taproot elongation rates of soybeans. Z Acker Pflanzenbau 146: 33–39. Le BT, Le MT (1998). Isolation of Genes and Selected Lines Unfavorable Environmental Tolerance in Rice. Hanoi, Vietnam: Vietnam National University (in Vietnamese). Uga Y, Sugimoto K, Ogawa S, Rane J, Ishitani M, Hara N, Kitomi Y, Inukai Y, Ono K, Kanno N et al. (2013). Control of root system architecture by deeper rooting 1 increases rice yield under drought conditions. Nat Genet 45: 1097–1102. Lee DK, Ahn JH, Song SK, Choi YD, Lee JS (2003). Expression of an expansin gene is correlated with root elongation in soybean. Plant Physiol 131: 985–997. Li F, Xing S, Guo Q, Zhao M, Zhang J, Gao Q, Wang G, Wang W (2011). Drought tolerance through over-expression of the expansin gene TaEXPB23 in transgenic tobacco. J Plant Physiol 168: 960–966. Li Y, Zhang J, Zhang J, Hao L, Hua J, Duan L, Zhang M, Li Z (2013). Expression of an Arabidopsis molybdenum cofactor sulphurase gene in soybean enhances drought tolerance and increases yield under field conditions. Plant Biotechnol J 11: 747–758. Libault M, Farmer A, Joshi T, Takahashi K, Langley RJ, Franklin LD, He J, Xu D, May G, Stacey G (2010). An integrated transcriptome atlas of the crop model Glycine max, and its use in comparative analyses in plants. Plant J 63: 86–99. Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2–ΔΔCt method. Methods 25: 402–408. Lo ST, Le SV, Nguyen TTV, Chu MH (2014). Cloning and designing vector carrying GmEXP1 gene isolated from local soybean cultivar Sonla, Vietnam. International Journal of Bioscience, Biochemistry and Bioinformatics 4: 191–194. Makbul S, Saruhan Güler N, Durmuş N, Güven S (2011). Changes in anatomical and physiological parameters of soybean under drought stress. Turk J Bot 35: 369–377. McQueen-Mason S, Cosgrove DJ (1994). Disruption of hydrogen bonding between plant cell wall polymers by proteins that induce wall extension. P Natl Acad Sci USA 91: 6574–6578. Topping JF (1998). Tobacco transformation. Methods in Molecular Biology 81: 365–372. Valente MA, Faria JA, Soares-Ramos JR, Reis PA, Pinheiro GL, Piovesan ND, Morais AT, Menezes CC, Cano MA, Fietto LG et al. (2009). The ER luminal binding protein (BiP) mediates an increase in drought tolerance in soybean and delays drought-induced leaf senescence in soybean and tobacco. J Exp Bot 60: 533–546. Wang Y, Suo H, Zheng Y, Liu K, Zhuang C, Kahle KT, Ma H, Yan X (2010). The soybean root-specific protein kinase GmWNK1 regulates stress-responsive ABA signaling on the root system architecture. Plant J 64: 230–242. Wu Y, Meeley RB, Cosgrove DJ (2001). Analysis and expression of the alpha-expansin and beta-expansin gene families in maize. Plant Physiol 126: 222–232. Xu P, Cai XT, Wang Y, Xing L, Chen Q, Xiang CB (2014). HDG11 upregulates cell-wall-loosening protein genes to promote root elongation in Arabidopsis. J Exp Bot 65: 4285–4295. Zhang G, Chen M, Chen X, Xu Z, Li L, Guo J, Ma Y (2010). Isolation and characterization of a novel EAR-motif-containing gene GmERF4 from soybean (Glycine max L.). Mol Biol Rep 37: 809–818. Zhou J, Xie J, Liao H, Wang X (2014). Overexpression of β-expansin gene GmEXPB2 improves phosphorus efficiency in soybean. Physiol Plant 150: 194–204. Zhu Y, Wu N, Song W, Yin G, Qin Y, Yan Y, Hu Y (2014). Soybean (Glycine max) expansin gene superfamily origins: segmental and tandem duplication events followed by divergent selection among subfamilies. BMC Plant Biol 14: 93. 995