Nội dung

Int.J.Curr.Microbiol.App.Sci (2019) 8(12): 700-707 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 8 Number 12 (2019) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2019.812.092 Molecular Characterization of Staphylococcus aureus Isolated from Foods of Animal Origin by Targeting Virulence and Antibiotic Resistance Genes Devender Choudhary*, Surendra Singh Shekhawat, Abhishek Gaurav, Hitesh Kumar and Nirmal Kumar Department of Veterinary Public Health, CVAS, Navania, Vallabhnagar, Udaipur (Raj.) -313601, India *Corresponding author ABSTRACT Keywords Milk, Meat, Egg, PCR, Virulence gene and antibiotic resistance gene Article Info Accepted: 07 November 2019 Available Online: 10 December 2019 Meat, milk and egg are a major component in the human diet and milk is an important food for vegetarian class, but it also serves as a very good medium for the growth of many microorganisms including pathogenic bacteria. In the present study, samples of milk, egg and meat were collected from different areas of Udaipur city. PCR assay was standardized for the detection of species specific genes16SrRNA gene, virulence gene (tsst gene) and antibiotic resistance gene (ermC, tetK, and aacA-aphD) of S. aureus. The prevalence of S. aureus was found to be 37.5%, 5%, and 15% in milk, egg and meat respectively. The prevalence of 16SrRNA, tsst, ermC, tetK, and aacA-aphD genes were recorded as 100%, 21.73%, 13%, 26% and 21.7% respectively. Introduction In developing countries, food borne diseases are one of the major causes of concern resulting in several deaths annually along with lots of economic burden.As per WHO, due to food borne pathogens approximately 600 million people are getting infected and around 4,20,000 die annually. Most cases of food borne outbreak which are caused by Staphylococcus aureus, Salmonella spp, Escherichia coli etc. had been reported worldwide (WHO, 2015). Staphylococcus aureus is an important opportunistic pathogen which is found both in humans and in dairy cattle. Staphylococcus aureus is one of the most prevalent causes of clinical infections globally (Kwon et al., 2006). In humans, S. aureus can cause a varied range of diseases relatively from minor skin infections to life-threatening infections such as endocarditis, pneumonia, and sepsis. In dairy cattle, this pathogen is considered as one of 700 Int.J.Curr.Microbiol.App.Sci (2019) 8(12): 700-707 the most common causative agents of mastitis (Haran et al., 2012). The presence of S. aureus or its enterotoxins is generally an indication of poor sanitation of food processing equipment. Meat is one of the important food item which is consumed worldwide, and is commonly contaminated by antibiotic resistant strains of S. aureus which pose a great risk to public health (Herve and Kumar, 2017). Eggs are one of the most wholesome and economical foods worldwide and are rich in proteins, fats, vitamins, and minerals (Kralik and Kralik, 2017). Poor handling and storage under unhygienic conditions in the poultry farms or shops poses a risk to egg quality and may consequently affect human health (Pyzik and Marek, 2012). In last few decades, excessive application of antibiotics in animal husbandry as preservative have led to the occurrence of drug resistance in microorganisms (Durbin 1956). The indiscriminate use of antibiotics in food animals for therapeutic purposes or as growth promoters is a primary factor in production of antimicrobial-resistant bacterial pathogens (Barber et al., 2003). Methicillin resistant S. aureus(MRSA) has emerged as a major concern for public health. MRSA has been found in several species of meat-producing animals, including pigs (Khanna et al., 2008; Smith et al., 2009), chickens (Nemati et al., 2008) and cattle (Hasman et al., 2010). During the past years, the prevalence of methicillinresistant Staphylococcus aureus (MRSA) has increased in many parts of the world (Witte, 1999). Therefore, in the present study an attempt was made to characterize Staphylococcus aureus from foods of animal origin by targeting virulence and antibiotic resistance genes. Materials and Methods Collection of samples A total of 120 samples comprising of milk (n=40), egg (n=40), and meat (n=40) were collected from different areas of Udaipur city. The samples were collected aseptically in sterile sampling vials and transported on ice packs to the laboratory under chilled condition. Isolation and identification After collection of samples, 1ml/1gm of the milk, egg and meat sample was inoculated in 9ml of buffered peptone water and incubated at 370C for 24 hrs. Then, a loopful of inoculum was streaked on selective media i.e. mannitol salt agar (MSA) and incubated at 370C for 24 hrs. After 24 hrs, the plates were observed for the presence of yellow colored colonies. Suspected colonies were further confirmed by biochemical tests viz., Gram’s staining, catalase, coagulase, haemolysis pattern, and motility. Molecular characterization of S. aureus Staphylococcus aureus isolates were subjected to PCR for finding out the presence of the 16S rRNA, tsst, aacA-aphD, ermC and tetK gene. The primers designed by Loveseth et al., (2004) (F5’GTAGGTGGCAAGCGTTATCC3’; R5’CGCACATCAGCGTCAG3’) were used for the detection of16S rRNA gene for confirmation of S. aureus. The primers used in the present study for detection of tsst gene (F5’GCTTGCGACAACTGCTACAG3’; R5’TGGATCCGTCATTCATTGTTAT3’) were designed by Loveseth et al., (2004). While, primers for aacA-aphD (F5’TAATCCAAGAGCAATAAGGGC3’; R5’GCCACACTATCATAACCACTA3’;) ermC(F-5’AATCGTCAATTCCTGCATGT3’; R- 5’TAATCGTGGAATACGGGTTTG’3;) 701 Int.J.Curr.Microbiol.App.Sci (2019) 8(12): 700-707 and tetK genes (F5’GTAGCGACAATAGGTAATAGT3’) (R5’GTAGTGACAATAAACCTCCTA3’) were designed by Strommenger et al., (2003). Standardization of PCR for the detection of 16S rRNA, tsst, ermC, aacA-aphD andtetK genes The PCR procedure to screen the 16S rRNAgene and tsst gene was standardized as described by Loveseth et al., (2004) with certain modifications. The cycling conditions of 16S rRNA were comprised of an initial denaturation at 94°C for 5 minutes, followed by 30 cycles of denaturation at 94°C for 1 minute, annealing at 54°C for 1 minute, extension at 72°C for 1 min and final extension at 72°C for 5 minutes. While for tsst gene, the cycling conditions were comprised of an initial denaturation at 94°C for 5 minutes followed by 30 cycles of denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute, extension at 72°C for 1 min and final extension at 72°C for 5 minutes. The PCR procedure to screen the antibiotic resistance genes viz., ermC, aacA-aphD and tetK was standardized as described by Strommenger et al., (2003). The cycling conditions were comprised of an initial denaturation at 94°C for 5 minutes, followed by 30 cycles of denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute, extension at 72°C for 1 min and final extension at 72°C for 5 minutes. Results and Discussion Out of the 120 samples screened, Staphylococcus aureus was isolated from 23 samples of foods of animal origin (milk, egg and meat) based on cultural and biochemical tests. On molecular analysis, 16S rRNAgene (Fig. 1) was detected in 100% (23/23) isolates. Detection of virulent tsst gene was found positive in 21.73% (5/23) of the isolates. PCR assay for antibiotic resistance gene ermC, aacA-aphD and tetK genes were found positive in 13.04% (4/23), 21.73% (5/23) and 26.08% (6/23) samples, respectively. In the present study, all the biochemically tested isolates were found positive for 16S rRNA gene, which was in accordance to the study conducted by Loveseth et al., (2004), Mukherjee et al., (2012), Wada et al., (2010), Bunnoeng et al., (2014), Al–Alak and Qassim (2016) and Roochetti et al., (2018). The present study revealed that all the phenotypically positive isolates were confirmed by PCR using 16S rRNA primer, which resulted in 100% positivity of the gene in all the presumptive isolates. As far as the result of tsst gene (Fig. 2) is concerned, our result was in accordance with Alni et al., (2018). However, the highest prevalence rates were revealed in the study conducted by Kooshaet al., (2016) and Loveseth et al., (2004) in which tsst gene prevalence was found to be 68% and 38% respectively, while a lower prevalence rate of 3.5%, 4.5% and 0% were also recorded for tsst gene by Aung et al., (2017), Shylaja et al., (2018) and Nemati et al., (2013) respectively. The prevalence of ermC gene (13%) (Fig. 3) in our study the findings were in accordance with the earlier studies conducted by Parvizi et al., (2012). Higher rates of prevalence were revealed by Ghanbari et al., (2016) and Lim et al., (2012) in which presence of ermC gene was found to be 44.4% and 21% respectively, while lower prevalence rate was revealed by Zmantar et al., (2011) in which 6% prevalence was found. The prevalence of aacA-aphD gene (Fig. 4) was almost in accordance with Kumar et al., (2010). Monecke and Ehricht (2005), Achek et al., (2018) and Ruban et al., (2017) showed 29%, 30.76% and 88% prevalence which was higher than our study, while lower prevalence (2.4%) was reported by Monecke et al., (2016). 702 Int.J.Curr.Microbiol.App.Sci (2019) 8(12): 700-707 Fig.1 Agarose gel showing PCR amplified product (228bp) for 16S rRNA gene in S. aureus isolates L–1kb DNA Ladder N – Negative Control Fig.2 Agarose gel showing PCR amplified product (559bp) for tsst gene in S. aureus isolates L–1kb DNA Ladder N – Negative Control 703 Int.J.Curr.Microbiol.App.Sci (2019) 8(12): 700-707 Fig.3 Agarose gel showing PCR amplified product (299bp) for ermC gene in S. aureus isolates L–1kb DNA Ladder N – Negative Control Fig.4 Agarose gel showing PCR amplified product (227bp) for aacA-aphD and (360bp) for tetK gene in S. aureus isolates L–1kb DNA Ladder N – Negative Control 704 Int.J.Curr.Microbiol.App.Sci (2019) 8(12): 700-707 The prevalence of tetK gene (Fig. 3) in the present study (26%) was in accordance with the findings of Emaneini et al., (2013) and Lim et al., (2012) who reported the prevalence as 17.2% and 21%, respectively. While higher rate of prevalence (72.97%) was revealed in the study conducted by Dehkordi et al., (2017), along with lower rate of prevalence (4.8%) which was reported in the study conducted by Monecke et al., (2016). In conclusion, the study reveals that variable level of prevalence has been due to high level of contamination of S. aureus in milk, egg and meat which is sufficient to produce food poisoning and leading cause of gastroenteritis. So proper treatment of milk, hygiene and clean environment of meat shop and poultry farm can reduce the contamination of S. aureus pathogen. Acknowledgement I am thankful to co-others Dr. Surendra Singh Shekhawat, Dr. Abhishek Gaurav, Dr. Hitesh Kumar, Dr. Nirmal Kumar and Dr. Subhash Chand Meena, Department of Veterinary Public Health, CVAS, Navania, Vallabhnagar, Udaipur for their guidance, co-operation and persistence motivation during entire period of study. References Achek, R., Hotzel, H., Cantekin, Z., Nabi, I., Hamdi, T.M., Neubauer, H. and El‑ Adawy, H. (2018). Emerging of antimicrobial resistance in staphylococci isolated from clinical and food samples in Algeria. BMC Res Notes, 11: 663. Al–Alak, S. K and Qassim, D. K. (2016) Molecular Identification of 16S rRNA gene in Staphylococcus aureus Isolated from Wounds and Burns by PCR Technique and Study Resistance of Fusidic acid. Iraqi J. Cancer Med. Genet. 9. Alni, H. R., Mohammadzadeh, A., Mahmoodi, P. and Alikhani, M.Y. (2018). Detection of Toxic Shock Syndrome Toxin (tsst) Gene Among Staphylococcus aureus Isolated from Patients and Healthy Carriers. Avicenna J Clin Microb Infec, 5(1). Aung,M.S, San,T., Aye, M.M., Mya, S., Maw,W.W., Zan,K.N., Htut,W.H.W., Kawaguchiya, M., Urushibara, N. and Kobayashi, N. (2017). Prevalence and Genetic Characteristics of Staphylococcus aureus and Staphylococcus argenteus Isolates Harboring Panton-Valentine Leukocidin, Enterotoxins, and TSST-1 Genes from Food Handlers in Myanmar. Toxins, 9: 241. Barber, D.A., Miller, G.Y. and McNamara, P.E. (2003). Models of antimicrobial resistance and food-borne illness: examining assumptions and practical application. J Food Prot. 66: 700-709. Bunnoeng, N., Themphachana, M., Pewleang, T., Kongpheng, S., Singkhamanan, K., Saengsuwan, P. and Sukhumungoon, P. (2014). High prevalence and molecular characterization of methicillin-resistant Staphylococcus aureus isolated from retailed meats, south Thailand. INT FOOD RES J. 21(2): 569-576. Durbin, C.G. (1956). Antibiotics in Food Preservation. Am J Public Health, 46: 1306-1308. Dehkordi, F., Gandomi, H., AkhondzadehBasti, A., Misaghi, A. and Rahimi, E. (2017). Phenotypic and genotypic characterization of antibiotic resistance of methicillin resistant Staphylococcus aureus isolated from hospital food. Antimicrob Resist Infect Control, 6:104. Emaneini, M., Bigverdi, R., Kalantar, D., Soroush, S., Jabalameli, F., NoorazarKhoshgnab, B., Asadollahi, P. and Taherikalani, M. (2013). Distribution of genes encoding tetracycline resistance and aminoglycoside modifying enzymes in Staphylococcus aureus strains isolated from a burn centre. Ann Burns Fire Disasters, 26(2). Ghanbari, F., Ghajavand, H., Havaei, R., Jami, MS., Khademi, F. and Heydari, L. (2016). Distribution of erm genes among Staphylococcus aureus isolates with inducible resistance to clindamycin in 705 Int.J.Curr.Microbiol.App.Sci (2019) 8(12): 700-707 Isfahan, Iran. Adv Biomed Res, 5:62. Haran, K. P., Godden, S.M., Boxrud, D., Jawahir, S., Bender, J.B. and Sreevatsan, S. (2012). Prevalence and characterization of Staphylococcus aureus, including methicillin-resistant Staphylococcus aureus, isolated from bulk tank milk from Minnesota dairy farms. J Clin Microbiol, 50(3): 688-695. Hasman, H., Moodley, A., Guardabassi, L., Stegger, M., Skov, R.L. and Aarestrup, F.M. (2010). Type distribution in originating from pigs, cattle and poultry. Vet Microbiol, 141(3-4): 326. Herve, D.T. and Kumar, G. (2017). Prevalence of Staphylococcus aureus in retail chicken meat samples in Jalandhar, Punjab. Research J. Pharm. Tech., 10(1). Khanna, T., Friendship, R., Dewey, C. and Weese, J.S. (2008). Methicillin resistant Staphylococcus aureus colonization in pigs and pig farmers. Vet Microbiol, 128: 298–303. Koosha, R. Z., Hosseini, H.M., Aghdam, E.M., Tajandareh, S.G. and Fooladi, A.A.I. (2016). Jundishapur J Microbiol, 9(2). Kralik, G. and Kralik, Z. (2017). Poultry products enriched with nutricines have beneficial effects on human health. Med Glas, 14(1): 1-7. Kumar, A., Rahal, A., Dwivedi, S.K. and Gupta, M.K. (2010). Bacterial Prevalence and Antibiotic Resistance Profile from Bovine Mastitis in Mathura, India. J Dairy Sci, 38: 31-34. Kwon, N.H., Park, K.T., Jung, W.K., Youn, H.Y., Lee, Y., Kim, S.H., Bae, W., Lim, J.Y., Kim, J. M., Hong, S. K. and Park, Y. H. (2006). Characteristics of methicillin resistant Staphylococcus aureus isolated from chicken meat and hospitalized dogs in Korea and their epidemiological relatedness. Vet Microbiol, 117(2-4): 304312. Lim, K. T., Hanifah, Y. A., Yusof, M. and Thong, K. L. (2012). ermA, ermC, tetM and tetK are essential for erythromycin and tetracycline resistance among methicillinresistant Staphylococcus aureus strains isolated from a tertiary hospital in Malaysia. Indian J Med Microbiol, 30:203-7. Løvseth, A., Loncarevic, S. and Berdal, K.G. (2004). Modified Multiplex PCR Method for Detection of Pyrogenic Exotoxin Genes in Staphylococcal Isolates. J Clin Microbiol, 42(8): 3869–3872. Monecke, S. and Ehricht, R. (2005). Rapid genotyping of methicillin-resistant Staphylococcus aureus (MRSA) isolates using miniaturised oligonucleotide arrays. Clin Microbiol Infect, 11(10): 825–833. Monecke, S., Gavier-Wide´n, D., Hotzel, H., Peters, M., Guenther, S., Lazaris, A., Loncaric, I., Muller, E., Reissig, A., Ruppelt-Lorz, A., C. Shore, A., Walter, B., C. Coleman, D. and Ehricht, R. (2016). Diversity of Staphylococcus aureus Isolates in European Wildlife. PLoS ONE, 11(12). Mukherjee, P., Karmakar, A., Biswas, S., De, S., De, S. and Ghosh, C. (2012). Analysis of Virulence Potentials of Community Acquired Staphylococcus aureus, Isolated from a Slam Population of West Bengal. IOSR Journal of Pharmacy, 2:5-12. Nemati, M., Hermans, K., Lipinska, U., Denis, O., Deplano, A., Struelens, M., Devriese, L.A., Pasmans, F. and Haesebrouck, F. (2008). Antimicrobial resistance of old and recent Staphylococcus aureus isolates from poultry: first detection of livestockassociated methicillin-resistant strain ST398. MBio, 52(10): 3817–3819. Nemati, M., Hermans, K., Pourahmad, F. and Haesebrouck, F. (2013). Prevalence of genes encoding exfoliative toxins, toxic shock syndrome toxin-1 among poultry Staphylococcus aureus isolates. Euro. J. Exp. Bio, 3(4): 89-92. Parvizi, M., Doosti, A. and Dehkordi, P.G. (2012). Detection of Antibiotic Resistance Genes in Staphylococcus aureus Strains Isolated from Cow’s Milk using Multiplex PCR Assay. J Pure Applied Microbio, 6(3): 1083-1088. Pyzik, E. and Marek, A. (2012). Characterization of bacteria of the genus Staphylococcus isolated from the eggs of Japanese quail (Coturnixcoturnix japonica). Pol J Vet Sci, 15(4): 767-772. Rocchetti, T.T., Martins, K.B., Martins, P.Y.F., 706 Int.J.Curr.Microbiol.App.Sci (2019) 8(12): 700-707 Oliveira, R.A., Mondelli, A.L., Fortaleza, C.M.C.B. and Cunha, M.L.R.S.(2018). Detection of the mecA gene and identification of Staphylococcus directly from blood culture bottles by multiplex polymerase chain reaction. Braz J Infect Dis, 22(2): 99-105. Ruban, S.W., Babu, R.N., Robinson, J.J.A., Kumar, S., Kumarasamy, T.M.A.P., Porteen, K. and Raja, P. (2017). Molecular detection of enterotoxigenic Staphylococcus aureus isolated from mutton marketed in retail outlets of Chennai, India. Indian J. Anim. Res., 0367-6722. Ruegg, P.L. (2003). Practical Food Safety Interventions for Dairy Production. J Dairy Sci. 86: 1-9. Shylaja, M., Goud, S.S.S., Samatha, K. and C,H. Pradeep. (2018). Studies on the incidence of Staphylococcus aureus and its enterotoxins in different meat and meat products. Pharma Innovation, 7(4): 669673. Smith, T.C., Male, M.J., Harper, A.L., Kroeger, J.S., Tinkler, G.P., Moritz, E.D., Capuano, A.W., Herwaldt, L.A. and Diekema, D.J. (2009). Methicillin-Resistant Staphylococcus aureus (MRSA) Strain ST398 Is Present in Midwestern U.S. Swine and Swine Workers. PLoS ONE, 4(1): 4258. Strommenger, B., Kettlitz, C., Werner, G. and Witte, W. (2003). Multiplex PCR Assay for Simultaneous Detection of Nine Clinically Relevant Antibiotic Resistance Genes in Staphylococcus aureus. J. Clin. Microbiol, 14(9): 4089–4094. Wada, M., Lkhagvadorj, E., Bian, L., Wang, C., Chiba, Y., Nagata, S., Shimizu, T., Yamashiro, Y., Asahara, T. and Nomoto, K. (2010). Quantitative reverse transcription-PCR assay for the rapid detection of methicillin-resistant Staphlyococcus aureus. J Appl Microbiol, 108(3): 779-88. Witte, W. (1999). Antibiotic resistance in grampositive bacteria: epidemiological aspects. J. Antimicrob. Chemother. 44:1–9. World Health Organization (WHO), Food safety, Fact sheet N 399, December 2015. Zmantar, T., Kouidhi, B., Miladi, H. and Bakhrouf, A. (2011). Detection of macrolide and disinfectant resistance genes in clinical Staphylococcus aureus and coagulase-negative staphylococci. BMC Research Notes, 4: 453. How to cite this article: Devender Choudhary, Surendra Singh Shekhawat, Abhishek Gaurav, Hitesh Kumar and Nirmal Kumar. 2019. Molecular Characterization of Staphylococcus aureus Isolated from Foods of Animal Origin by Targeting Virulence and Antibiotic Resistance Genes. Int.J.Curr.Microbiol.App.Sci. 8(12): 700-707. doi: https://doi.org/10.20546/ijcmas.2019.812.092 707