Nội dung

Int.J.Curr.Microbiol.App.Sci (2020) 9(2): 2640-2653 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 9 Number 2 (2020) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2020.902.301 Fine Mapping and Expression Analysis of Stripe Rust Resistance Genes derived from Aegilops geniculata Shivendra Kumar*, Satinder Kaur, Parveen Chhuneja, Mitaly Bansal and Indrajeet Singh Yadav School of Agricultural Biotechnology Ludhiana (Punjab) 141004, India *Corresponding author ABSTRACT Keywords Aegilops geniculata, KASper markers, Introgression, SNP, Stripe rust, Leaf rust Article Info Accepted: 18 January 2020 Available Online: 10 February 2020 Wheat production in temperate area is significantly affected by rust diseases, among which stripe (or yellow) rust caused by Puccinia striiformis Westend f. sp. tritici and leaf (or brown) rust caused by Puccinia triticina Eriks. is major threat to production. Non-progenitor Aegilops species with substantial amount of variability for stripe rust resistance genes has been exploited to a limited extent. A tetraploid non-progenitor species (UUMM genome), namely Aegilops geniculata accession pau3549 is found to be resistant to stripe rust. A stripe rust resistant introgression line-ILT598 (BC2F8 Ae. geniculata acc. pau3549/CSS//3*WL711) was already available. In the present investigation an F5 population was derived from the cross of ILT598 with wheat cultivar WL711(NN). Inheritance studies in F5 population revealed that stripe rust resistance is controlled by a single dominant gene, temporarily designated as YrAg. Mapping of YrAg was done by using SNP based KASper marker linked with two group of linked gene on chromosome 5DS viz Lr57-Yr40 and Lr76-Yr70 and one marker was designed from candidate gene of comp_121307_c0_seq4 derived from ILT598. Molecular mapping using F5 population mapped YrAg at a distance of 3.3cM from KASP comp_121307_c0_seq4 towards distal end of chromosome 5D. Introduction Bread wheat (triticum aestivum l. Thell, 2n=42) is a widely cultivated crop in India or worldwide and a potent source of nutrients. It occupies 17% of global crop area feeding about 40% of the world population (https://en.wikipedia.org/wiki/ international wheat production). It grows on 215 million hectares with global production stands at 739.5 million metric tons (CGAIR 2017), (FAOSTAT homepage; http://apps.fao.org) representing 19% of global cereal production with the world population is expected to grow from present 7.0 billion 9.0 billion by 2050, India is the second largest wheat producer in the world and among the Indian states, Punjab is ranked second in wheat production after 2640 Int.J.Curr.Microbiol.App.Sci (2020) 9(2): 2640-2653 UtterPradesh. Stripe (yellow) rust (YR) caused by Puccinia striiformis f.sp. Tritici, is one of the major diseases of wheat in temperate regions also found in the tropics and subtropics. It infects leaves, leaf sheath and spikes of a wheat plant. This can infect barley, rye and more than 50 grass species also (Line 2002). The losses to wheat crop due to YR varies from 10-70 percent, depending upon the weather, races of pathogen, susceptibility of cultivar, and time of infection (Begum et al., 2014). The regular use of limited parental genotypes in the advanced wheat breeding practices and monoculture of few improved wheat varieties results in a narrow genetic base in the cultivated wheat. Breakdown of mega variety PBW343 due to evolution of virulence against gene Yr27 is an example of pathogen evolution when a single variety is grown over large area (Prashar et al., 2007). New races of pathogen may develop through mutation or recombination of nuclei via a para-sexual process. Different YR genes includes seedling resistance or all time resistance genes Yr1.Yr2, Yr3, Yr4, Yr5, Yr6, Yr7, Yr8, Yr9, Yr10, Yr15, Yr17, Yr27 and adult plant resistance genes: Yr11, Yr12, Yr13, Yr14, Yr16, Yr18, Yr36, etc. (Mclntosh et al., 1995). Fungicides are the only alternative to genetic resistance, their use increase the cost of production along-with increasing soil and water pollution and other pathogen resistance issue Thus, there is need to look for constant and diverse source of resistance. Therefore need to stack variable R genes instead of single R gene to induce the durable resistance. The germplasm of wild progenitor species consists huge reservoir of various resistance traits. This has led to inter-specific breeding for transferring preferred gene from wild progenitor into commercial cultivars (Knott 1981, Dvorak 1976, Stalker 1980, Dhaliwal et al., 1993). To date more than 76 YR (Xiang et al., 2016) R gene have been categorized and almost half of these genes derived from their progenitor as well non-progenitor species. Evaluation of wild wheat germplasm at PAU for the past 20 years led to the identification of C, U, and M genomes from wild Triticum and Aegilops species as a potent resource for resistance to leaf and stripe rusts. Aegilops geniculata is a diploid (2n=42) non-progenitor species with UUMM genome. One of the accessions of Aegilops geniculata designated as pau3549 was resistant to stripe rust/yellow rust (YR) and leaf rust (LR). Ph1 mediated induced homeologous pairing resulted in transfer of 5mgl to chromosome 5D of wheat. Initially a disomic substitution line DS5M (5D) have been developed and this line was crossed with a Chinese Spring (CS) stock carrying the Ph1 locus (Ph1 locus is responsible for homeologous recombination) (Chen et al., 1994). F1s from this cross were further crossed with WL711, a local variety susceptible to leaf rust and stripe rust (Aghaee-Sarbarzeh et al., 2002). One more backcross with WL711 and selfing of stable, leaf rust and stripe rust resistant plants with chromosome number 2n=42 were carried forward and BC2F8 WL711-Ae.geniculata stable introgression lines (IL) were developed. Two of these IL were IL T598 (TA5601) and IL T756 (TA5602). Molecular marker and GISH analysis of these two IL revealed the transfer of 5mgl to chromosome 5D of wheat. IL T756 has had the smaller fragment from Ae geniculata [T5DL·5DS-5mgs (0.95)] and is fully resistant to leaf rust while moderately resistant to stripe rust (40MS). Linked gene Lr57-Yr40 had already been mapped in IL T756 (Kuraparthy et al., 2008). IL T598 on other hand was completely resistant (0) to leaf rust as well as stripe rust with a larger fragment from Ae. Geniculata [T5DL·5DS- 2641 Int.J.Curr.Microbiol.App.Sci (2020) 9(2): 2640-2653 5mgs (0.75)] (Kurapathy et al., 2008). The present investigation was proposed with three objectives 1. Study genetics of stripe rust resistance genes in ILT598. 2. Molecular mapping of stripe rust resistance genes in ILT598. Comparative gene expression analysis of stripe rust resistance in ILT756 (YR40) and ILT598. Materials and Methods The present investigation was performed at the experimental area and Molecular Biology Laboratory, School of Agricultural Biotechnology, Punjab Agricultural University, Ludhiana. tritici race 110S119 and 100S84 (pst) was used. Race 110S119 is the most dominant race against stripe rust resistance responsible for knocking down of known gene. The cultures were obtained from Regional Station, Directorate of wheat research (DWR), Flowerdale, Shimla. Raising the seedlings and inoculation To raise the seedling of BC2F4 population displayed as WL711-introgression line (developed through crosses of introgression line T598 with WL711 (TA4325-152). The landrace „WL711' was used as the susceptible check (initially WL711 has Lr 11 and Lr 13 in present scenario both of the leaf rust resistance gene Lr 11 and Lr 13 became recessive (Gupta AK et al., 1984)). Material Stripe rust resistant Wheat-Ae.geniculata introgression lines (IL) T598 (TA5601), ILT756 (TA5602) and susceptible cultivar WL711 NN=Non-Necrotic) were used as a parental line. F4 population derived from a cross of ILT598 with WL711(NN) and ILT756 respectively (leads to crosses). The seedlings were raised in glasshouse maintained at 18-200C and 100% Relative humidity. The first leaf of seven days old seedlings was inoculated using spearhead needle with the homogenous urediniosporestalc mixture of yellow rust race 110S119 and 100S84 under above mentioned environmental condition. Methods Scoring of infection types (IT) The present investigation was carried out as three different experiments. The infection types (ITs) were recorded 14 days after inoculation using the scale of Stakman et al., (1962) as shown in Table1. Seedlings with ITs, ranging from 0; and; were categorized as resistant and 3 as susceptible. Experiment 1 Genetics of yellow rust resistance gene (s) transferred from Ae. geniculata in IL T598 (TA5601) (Kuraparthy. V et al., 2007). Screening for Yellow rust resistance at the seedling stage Pathogen Screening of stripe rust resistance under field conditions (natural temp and relative humidity) Stripe rust infection was recorded at the adult plant stage as the percentage of leaf area covered with rust urediospores, according to the stakman rule. A single spore culture of Puccinia striformis 2642 Int.J.Curr.Microbiol.App.Sci (2020) 9(2): 2640-2653 Statistical analysis The chi-square test will be used for testing goodness of fit of the data to the expected genetic Chi-square (χ2) was applied to test goodness of fit of the expected ratios to the observed ones. Following expression was used for calculating chi-square values χ2(n- 1)d.f = (O-E)2/E Experiment 2 Molecular mapping of yellow rust resistance genes using bulked segregant analysis. Isolation of genomic DNA and genotyping of the Ae.geniculata derived population Genomic DNA was isolated using CTAB method (Saghai Maroof et al., 1994) of 30 days old seedling leaf tissues were used collected from the field. DNA of all two BC2F4 progenies along with advanced generation of BC2F4 ((IL) T598 * WL711 (NN))was BC2F5. One of the BC2F4 population was developed through a cross between introgression line (IL) T598 to cultivar WL711. Second BC2F4 = ILT598*ILT756. Extracted sample were quantified using a NanoDrop® ND-1000 and ND-8000 8-Sample Spectrophotometers instrument KASP genotyping For KASP genotyping primer mix was prepared as per the recommendations by LGC Genomics by adding 46 μl dH2O, 30 μl common primer (100 μM) and 12 μl of each tailed primer of 100 μ concentration. KASP genotyping assays were tested in 384-well format and each assay was set up as 4 μl reactions (2 μl template DNA (final concentration of 20–30 ng of DNA), 1.944 μl of v4 2x KASP mix (LGC Genomics, Teddington, UK), and 0.056 μl primer mix). PCR was performed on a Eppendorf Master cycler pro 384 using the following temperature profile: hot start at 95°C for 15 min, followed by ten touchdown cycles (95°C for 20 s; touchdown at 65°C with -1°C per cycle for 1 min) then followed by 30 cycles of amplification (94°C 20 s; 57°C 1 min). 384well optically clear plates (Cat. No. E10423000, Starlab) were read on a Tecan Safire plate reader. Fluorescence was visualized at a set temperature 370C. The fluorescence intensity scanning was then imported to KlusterCaller software (v 2.22.0.5, LGC Genomics) to check the cluster formation. If the defined genotyping clusters had not formed after the initial amplification, additional 5 to 10 amplification cycles were given in terms of add5, and the samples were scanned again. Further data analysis and scoring were performed manually using Klustercaller software. KASP technology (a PCR based genotypic mechanism) was developed by LGC-Genomic and set a recommended standard KASP protocol. LGC-Genomic put standard with three well plate system respectively 96, 384 & 1542 well plate system. Primer designing We have RNA Seq data of ILs T598 and WL711 at six different time intervals 0hr, 12hr, 24hr, 48hr, 72hr and 96hr (Yadav et al., 2016) all processes done in BIOINFORMATICS LAB school of agricultural biotech ludiana punjab. One of the genes selected ID comp_121307307_c0_seq4 was selected as it was NBS-LRR encoded and high confidence gene. Statistical analysis Mapping software MAPDISTO were used for 2643 Int.J.Curr.Microbiol.App.Sci (2020) 9(2): 2640-2653 computing the distance between the markers and trait (Lorieux 2007). The map was drawn using the programme MAPCHART version 2.1 developed by Voorips (2002). Experiment 3 Expression analysis of candidate genes contributing towards yellow rust resistance. Raising the seedlings, inoculation and sample collection Seedlings of IL (BC2F4 generation) T598, IL T756, and a parental cultivar WL711(NN) were raised and first leaf of seven days old seedlings had infected with aYr race 110S119 + talc. The inoculated seedling was incubated in a dark chamber maintained at 20°1°C at 100% RH for 16h (Nayar et al., 1997). Leaf samples were collected at different time interval of 0 hours, 6 hours, 12 hours, 24 hours, 48 hours 72 hours and 96 hours in three biological replicates followed by 14th days rust appearance. cultivar WL711 have been sequenced for RNA-Seq (cDNA) at six different time interval 0hr, 12hr, 24hr, 48hr, 72hr and 96hr (all RNA Seq data were generated from RNA which sample was inoculated with the 77-5 race of leaf rust) in another project. The reference Transcriptome Shotgun Assembly of WL711 submitted at GenBank (AC. GEWU00000000) was used as reference. The differentially expressed genes were investigated through using bioinformatic tools in SOAB-ludhiana and final candidate gene were investigated based on FPKM value (table: 7 and fig. 3) of expression over bar graph. All five sequences related to comp121307_c0_seq4 gene sequence (candidate sequence out of 5 isolated sequence) were aligned and the SNPs identification had accomplished. Based on the SNPs site primer for KASP genotyping and QRT-PCR were designed. All primer designing has done with Vector-NTI Advanced software. Real-time quantitative RT-PCR Total RNA conversion extraction and c DNA Using Trizol manual method and RNA quantification done with 1.2% Denaturing gel based running gel unit. Prime Script™ first strand cDNA Synthesis Kit based cDNA Synthesis. c-DNA quantification using NanoDrop® ND-1000 and ND-8000 8Sample Spectrophotometers instrument Expression analysis using real-time quantitative PCR conduncted on the cDNA samples of IL T598, IL T756 and cultivar WL711 for six different time interval in triplicate The PCR amplification efficiency was determined for each primer combination by the slope of the standard curve obtained by plotting the fluorescence versus concentration of the individual cDNA of sample ILT598, ILT756, and cultivar WL711. For RNA and c-DNA quantification OD value taken respectively 2.0 and 1.8 for expression analysis. Real-time quantitative PCR- assay Transcriptome analysis and identification of candidate gene Done all the QRT PCR reaction with LightCycler96 well plate qRT PCR (Roche). A total of 10 microliters of PCR reaction was performed at the School of Agricultural Biotechnology in wheat genomics lab. QRT- Introgression line T598 and susceptible 2644 Int.J.Curr.Microbiol.App.Sci (2020) 9(2): 2640-2653 PCR reaction per performed with cDNA and two type of primer one was constitutive primer (Tubulin primer) and second was target primer (121307_c0_seq4) within the single white PCR Plate of 96-well, segmented, semi-skirted. Simultaneously a negative-template control (NTC) negative control was performed in same 96 PCR well plates. The pcr profile were used as intial denaturation at 94°C/4 min, denaturation at 94°C/1min, annealing at 56°C/1min extension 72°C/1min, and final elongation 94°C/7min. selected initially with the hypothesis that ILT598 also has YR gene on the chromosome 5DS. Thus 41SNP markers have been selected of which 9 markers reported to be linked with Lr57-Yr40and 33 markers have been linked with Lr76-Yr70 (Table: 3). Another new marker has been designed from candidate gene sequence derived from RNA sequence data of IL-T598 (candidate gene sequence from RNA extracted after inoculation with leaf rust pathogen) in table: 4 . Selection of candidate gene Results and Discussion The segregation of 250 progenies in F5 generation fit into 1.75HR: 0.5 Segr:1.75HS progenies with chi square value 4.4 indicating a single gene for YR resistance in ILT598. Since ILT598 is resistant at SS while WL711 is susceptible the YR resistance of ILT598 is due to seedling resistance gene also known as all-time resistance gene. Thus YR resistance of ILT598 is due to single resistance gene effective at all stage of plant growth. The gene was temporarily designated as YrAg. Possible candidate R-gene transcripts were selected, which have homologs on chromosome 5DS, as resistance gene in an another IL-T756 was previously mapped short arm of chromosome 5D (Kuraparthy et al., 2008). Finally we identified six R-genes mapping to chromosome 5DS, filtered on the basis of maximum percent identity >99% and >98% query coverage. FPKM (Fragments PerKilobase of transcript per Million mapped reads) values of these mapped transcripts were extracted for both WL711 and ILT598 at 6 time intervals and were averaged for replicates. One R-gene (named comp_121307_c0_seq4) transcript demonstrating consistent expression in term of FPKM values was selected. Mapping of stripe rust resistance gene Genotyping of F5population Selection of markers for mapping of YR resistance The selected 42 selected markers from chromosome 5DS were amplified on parental lines ILT598 and WL711, of which nine were found to be polymorphic including one marker linked toLr57/Yr40, seven markers linked to Lr76/Yr70 and one marker from selected candidate gene from 5DS. These nine markers were further amplified on the 250 F5progenies. The entire 9 marker found to be associated with YrAg gene leading to formation of linkage map of 7.72cM with KASP marker comp_121307_c0_seq4 being Inheritance of stripe rust resistance in ILT598 and WL711 against YR race 110s119 and 110s84 and list of Resistance, susceptible and homozygous in table: 1 & 2 Linked LR and YR and genes have already been reported on chromosome 5DS Lr57/Yr40 from Ae. geniculata (Kuraparthy et al., 2007) in ILT756, a sister line of T598.Another linked geneLr76/Yr70from Ae. Umbellulata have also been mapped on chromosome 5DS (Bansal et al., 2017). The SNP markers for both pair of genes reported by Kuraparthy et al., (2016) and Bansal et al., (2017) were 2645 Int.J.Curr.Microbiol.App.Sci (2020) 9(2): 2640-2653 closest at a distance of 3.3cM (Fig 1). All the markers were scored as co-dominant markers with “A” given to susceptible WL711 allele, “B” given to resistant ILT598 allele and “H” given to progenies amplifying both the resistant and susceptible alleles in fig 2. Segregation of three alleles in F5 population is given in Table: 5. Validation of candidate gene using qRTPCR The real-time PCR has been performed to validate the time a specific level of transcription of a leaf rust resistance and stripe rust in the fig. Resistance genes respectively. Samples were collected from two resistants IL T598 and T756 and one susceptible cultivar WL711 at six different time intervals after the inoculation with respective pathogen. Real time PCR primers have been designed from candidate gene comp_121307_c0_seq4. Expression analysis report for validation of comp_121307_c0_seq4 using QRT-PCR qRT-PCR was done for real-time expression analysis, among leaf samples of at six different time interval (0, 12, 24, 48, 72 and 96 hr after leaf rust and stripe rust inoculations). Samples were collected in the month of November 2017 in RNA later solution. Validation of the candidate reference gene comp_1231307_c0_seq4 qRT-PCR was done in School of Agricultural Biotechnology (SOAB) Ludhiana (Wheat Molecular Biotechnology Lab). For a successful qRTreal-time experiment, housekeeping gene alpha-Tubulin was used as internal control among the most commonly used reference gene for wheat (Teneaet al., 2011). Expression profile comp_121307_c0_seq4 The expression of for comp_121307_c0_seq4gene relative to an alpha-tubulin gene in stressed plants was determined using 2-∆∆CT method (Livak and Schmittgen 2001). Using 2-∆∆CT method, the fold change in candidate121307_c0_seq4gene expression for different time interval transcript normalized to tubulin gene and related to the mock plants was determined. Relative changes depict in terms of threshold cycle (CQ) value. It has been used for detection of expression level. Cq value is the amplification cycle number over which fluorescent signal reached above the baseline. Baseline level has been standardized to mean. A CQ value will be inversely proportional to the level of expression (Zhi et al., 2016). The expression profile of wheat developmental stage was investigated by candidate gene comp_121307_c0_seq4, which depicts the level of expression for all three parental line IL T598, IL T756 and WL711. The expression profile reveals the concept of the candidature of gene for leaf rust and stripe rust resistance. Expression analysis of comp_121307_c0_seq4 gene after leaf rust inoculations Relative gene expression was calculated in three ILT598, ILT756 and WL711 at six different time interval as shown in Table: 9. In IL-T598, IL-T756 and susceptible cv.WL711 the transcripts of gene comp_121307_c0_seq4 were detectable at all six different time intervals. Resulted fold expression were shoot up to a higher level in IL T598 and maximum 5.4041 at 24hr, subsequently hypersensitive response decreases simultaneously relatively fold expression fall down to 1.652. Similarly for IL T756 relative fold expression were observed maximum 2.10 at 12hr, further candidate 2646 Int.J.Curr.Microbiol.App.Sci (2020) 9(2): 2640-2653 declined 1.22 at 24hr and 0.732 at 48hr. In WL711 relative fold expression has been observed 0.335 almost throughout the all six different time interval. The elevated pattern of increase in expression of comp_121307_c0_seq4 was noticed at 24hr for IL T598, at 12hr for IL T756 shown in fig 4. The results showed a higher expression of leaf rust resistance gene from ILT598 as compared to ILT756 indicating a different R gene controlling the resistance in both the introgression lines. Inheritance of stripe rust resistance in ILT598 and WL711 against YR race 110s119 and 110s84 and list of Resistance, susceptible and homozygous in table: 1 & 2. Table.1 S.No 1 2 STAGE SEEDLING STAGE (SS) ADULT ILT598 ;1 0-TR WL711 3-3+ 60S-80S Table.2 S.No RESISTANCE 20MR) 120 1 (0- SUSCEPTIBLE(20S60S) 109 HOMOZYGOUS(TR40S) 19 Table.3 KASP markers specific to alien introgression on chromosome 5DS S. No. 1 2 3 Source of SNP markers Non-progenitor No. of Number of Polymorphic involved in markers polymorphic KASP introgression/genome applied to markers markers introgressed on the F2 chromosome 5DS population Lr57/Yr40(IL-T756) Aegilops 9 1 KASP3 (Tiwari et al., 2015) geniculata/UUMM Lr76/Yr70 Aegilops 33 7 KASP178 (Bansal et al., 2017) umbellulata/UU (Plate3), KASP71, KASP119, KASP217, KASP221, KASP228, KASP117 Gene ID Aegilops 1 1 KASP1 comp_121307_c0_seq4 geniculata/UUMM (IL-T598) Total 42 2647 9 Int.J.Curr.Microbiol.App.Sci (2020) 9(2): 2640-2653 Table.4 Sequence of different KASP markers used for mapping of YR resistance gene in ILT598in present study KASP_121307307_c0_seq4 information S. No Primer Sequence 1 Lr57_cds_kasp1_FAM GAAGGTGACCAAGTTCATGCTTTTTGGACCTgGCATGGAATAAGC 2 Lr57_cds_kasp1_HEX GAAGGTCGGAGTCAACGGATTTTTTGGACCTgGCATGGAATAAGT 3 Lr57_cds_kasp1_COM AGATTCCTGAGCCTTGTTACTTCGG Table.5 Segregation of different alleles in selected polymorphic KASP markers in F5 population derived from T598X WL711 Marker Lr76/Yr70_KASP1 Lr57/Yr40_KASP3 Lr76/Yr70_KASP117 Lr76/Yr70_KASP119 Lr76/Yr70_KASP178 Lr76/Yr70_KASP221 Lr76/Yr70_KASP228 Lr76/Yr70_KASP71 Lr76/Yr70_KASP217 COMP_121307_CO_SEQ4 F5 Population H 34 0 35 29 32 31 32 32 26 33 B 94 126 92 94 96 96 94 94 93 90 All the selected KASP markers segregated in expected ratio of 1.75HR:0.5segr.:1.5HS, except marker Lr57/Yr40_KASP3 which showed segregation distortion with no heterozygous progenies (table5). Expression analysis of comp_121307_c0_seq4 gene after stripe rust inoculation The transcripts of comp_121307_c0_seq4 gene were detectable at all six different time intervals. There was increase in fold expression in IL T598 and maximum 1.077 at 24hr,(Table: 10) subsequently hypersensitive response decreases simultaneously relatively fold expression fall down to 0.246 at 48 hr. In IL T756 relative fold expression were observed maximum 10.65 at 12hr, further A 122 125 122 121 121 123 117 117 127 117 Chi Square value 3.86 35.9 4.68 3.5 2.9 3.33 2.59 2.59 6.21 3.81 declined 1.14 at 24hr and 0.695 at 48hr. In susceptible cultivarWL711 relative fold expression has been observed 0.335 almost throughout the all six different time interval. The elevated pattern of increase in expression of comp_121307_c0_seq4 was noticed at 24hr for IL T598, for IL T756 it was maximum at 12hr and in case of WL711 gene expression at baseline shown in fig 5. qRT-PCR results showed that might be different alleles of stripe rust resistance gene will be responsible for abrupt fold change (10.65) in T756 than in T598.gene). In T598 the expression of leaf rust and stripe rust transcript increases to maximum 24 hr after inoculation while in ILT756 maximum transcript were raised after 12 hr of inoculation indicating a separate mechanism of expression in both the introgression lines derived from same source. 2648 Int.J.Curr.Microbiol.App.Sci (2020) 9(2): 2640-2653 Table.6 Details of six candidate genes identified from RNA sample taken at six different time interval in IL-T598 S.No. Ids Chr 1 2 3 4 5 6 Comp_44675_c0_seq1 Comp_92855_c0_seq2 Comp_110328_c0_seq1 Comp_113501_c0_seq1 Comp_114926_c1_seq1 Comp_121307_c0_seq4 chr5D chr5D chr5D chr5D chr5D chr5D % Alignment Q start Q end End identity length point 100 482 555065344 555065825 891 100 1839 555050581 555048743 3397 99.889 2700 555046066 555048765 4968 99.92 2493 193130396 193132887 4591 99.599 2493 193132887 193130396 4547 99.517 2279 28483925 28481647 4148 Table.7 Mean FPKM value of comp121307_c0_seq4 of all 6 different time intervals S.No. Time interval IL T598 WL711 1 0hr 0.176667 0.38 2 12hr 0.845 0.09333 3 24hr 0.58 0.25667 4 48hr 0.055 0.66333 5 6 72hr 96hr 0.375 2.09 0.30667 1.23 Table.8 Primer information for RT-PCR S.No 1 primer Alpha tubulin F Alpha-tubulin R Gene sequence 5‟AGGAGGATGCAGCCAACAAC3‟ 5‟AGGGCCAGAGCCAGTTCCA3‟ Tm value (0C) 58 2 Lr57_cds_RT_F Lr57_cds_RT_R 5‟AGATTCCTGAGCCTTGTTACTTCGG3‟ 5‟TAAGCTGTCgGGAAGATTGCCTAC3‟ 58 Table.9 Relative change in fold expression of candidate comp_121307_c0_seq4 for leaf rust infected transcript ILS/Time interval 0HR 12HR 24HR 48HR 72HR 96HR ILT598 1 1.153672 5.404151 1.652991 0.059284 0.007882 ILT756 1 2.109344 1.220928 0.732692 0.011861 0.000829 2649 WL711 1 0.332754 0.029429 0.335372 0.000744 0.000196