Nội dung

Int.J.Curr.Microbiol.App.Sci (2019) 8(8): 2527-2543 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 8 Number 08 (2019) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2019.808.294 Differential DNA Methylation under Drought Stress in Maize Nehal Sallam1,*, Mounir Moussa1, Mohamed Yacout 1 and Ayman El-Seedy1 Department of Genetics, Faculty of Agriculture, Alexandria University, Alexandria, 21545, Egypt *Corresponding author ABSTRACT Keywords DNA Methylation, Drought Stress, Maize, DNA analysis Article Info Accepted: 22 July 2019 Available Online: 10 August 2019 DNA methylation plays a vital roles in plant response to drought stress. Therefore, the present study was carried out to investigate differential cytosines methylation in leaves of maize under drought stress by using AMP method. Thirty days old maize seedlings were subjected to water deficit for nine days and the leaves of drought stressed plants and control plants were collected and stored at -20 until DNA extraction and subsequence DNA analysis. We isolated and sequenced 18 differentially methylated fragments. DMF 4, DMF 10, and DMF 13 were found to be homologous to lncRNA genes, DMF3 is similar to protein dehydrationinduced 19 homologue 3 and DMF 18 is homologous to nudix hydrolase 2 gene. The obtained results indicated that lncRNAs are consider as important regulators in response of maize plant to drought stress. Introduction Drought is one of the abiotic stresses that affect plant growth, productivity and cause significant crop losses on annual basis. Therefore, it is important to know how plants respond to drought stress by altering its biological activities. Plant faces abiotic stress by epigenetic changes that modify gene expression of the drought-responsive genes (Setter et al., 2011; Boyer et al., 2012; Kakumanu et al., 2012; and Mao et al., 2015). Epigenetic changes, such as cytosine DNA methylation, in plants play crucial roles in gene expression and silencing of transposon. There are four different types of DNA methyltransferases that achieve the methylation of cytosines in three different forms, CG, CHG, and CHH (Chan et al., 2005; Zhang et al., 2006 and Suzuki and Bird, 2008). Recent studies have revealed that plant responds to abiotic stress by methylation of genomic DNA (Steward et al., 2002 and Choi 2527 Int.J.Curr.Microbiol.App.Sci (2019) 8(8): 2527-2543 and Sano, 2007). Under abiotic stresses, it has been revealed that cold stress induced DNA methylation in maize (Steward et al, 2002). Drought stress induced specific cytosine hypermethylation in the pea genome (labra et al, 2002) and induced methylation alteration in leaves of maize seedlings (Tan, 2010). It was found that after drought stress in Populus, the levels of methylated cytosines significantly increased, including 2kb upstream and downstream from transcription start sites, and in repetitive sequences (Liang et al., 2014). application of drought stress treatments. Macro elements NPK fertilization, urea (46% nitrogen, monosuperphosphate (12.5% phosphate) and potassium sulfate (50% potassium) were added to each soil of plant pot at 15, 25 and 37 days after planting date. Fertilization was applied using a slow-release fertilizer consisted of 0.6% ferrous, 0.6% Manganese, 0.6%Zinc, 0.08% Copper and 0.08% Magnesium was added once a weak until the application of drought stress treatments. Drought stress application Certain lncRNAs are induced during abiotic stress and play critical regulatory roles in plant response to environmental stress (Wang et al, 2017). It was found that droughtinduced lncRNA in Arabidopsis thaliana which indicated the important role of lncRNAs in regulating plant tolerance to abiotic stress (Qin et al., 2017). Although some studies on the role of lncRNAs in plants have been carried out, comprehensive studies of the response of the lncRNA to drought stress remain limited. Therefore, the present investigation was carried out to detect methylation polymorphism due to water stress in maize by using amplified methylation polymorphism method. Materials and Methods Growth conditions Maize inbred line W22 was used in the current investigation, which supplied by the United States Department of Agriculture (USDA).A single seed was grown in about 7 liter plastic pots containing sand soil in July 2015. Temperatures ranged between 33 to 29 for high temperatures and between 26 to 22 for low temperatures, the average of the relative humidity was 68.47% during the period of this experiment. Maize seedlings were irrigated to field capacity until the Drought stress was carried out on thirty days old seedlings by preventing the irrigation of plants for nine days, while control plants were irrigated regularly. Leaves of control and drought-stressed plants were collected and stored at -20°C until DNA extraction and subsequent DNA analysis. DNA extraction from leaves of maize inbred line W22 plants was carried out by using bioPLUS kit. Determination Concentration of DNA purity and To determine DNA purity and concentration of the genomic DNA isolated from leaves of the maize inbred line W22, the ultraviolet spectrophotometer method was used as described by Glasel (1995); Huberman (1995) and Manchester (1996). Procedure of polymorphism amplified methylation To detect DNA methylation, the amplified methylation polymorphism (AMP) method described by (Phutikanit et al., 2010) with modification was used. Genomic DNA of leaves of inbred line W22 was digested by HpaII and MspI restriction enzymes, as recommended by New England BioLabs. Purified digested DNA samples were 2528 Int.J.Curr.Microbiol.App.Sci (2019) 8(8): 2527-2543 amplified by using a single primer contain the recognition sequence of the two isoschizomers (CCGG). PCR amplification was performed in 25 µl of a reaction mixture containing 1 unit Taq polymerase (Thermoscientific), 1X reaction buffer (containing 5 mM dNTPs, 15 mM MgCl2, stabilizers, and enhancers) and 0.5 µM of single decamer primer (Biosearch technologies, USA). The sequences of the primers used in this study are shown in table (1). The cycling program included initial denaturation of one cycle at 95 °C for 3 minutes,denaturation at 95 °C for 45 seconds, the annealing temperature of 37°C, and extension at 72 °C–1 min for a total of 35 cycles and a final extension at 72°C–7 min for 1 cycle. Amplified PCR products were separated at 6% polyacrylamide gel and stained by silver nitrate (Bassam and Gresshoff 2007). Recovery of selected PCR products PCR products were purified from 18differentially methylated bands as described by Sanguinetti et al., (1994), reamplified with the same PCR conditions, and subjected to cloning by using the pGEM®-T Easy Vector System I. DNA sequencing and data analysis Positivecolonieswere sent toGenewiz(United Kingdom) for sequencing. BLAST searches against Zea mays genome databases at the NCBI (http://blast.ncbi.nlm.nih.gov) website was used to identify the resulting sequences. Results and Discussion Drought-stressed maize inbred line W22 plants showed the rolling leaves, a result of water deficit, as the rate of transpiration exceeds water uptake (McCue, 1990) in comparison with normal plant leaves of control plants (Figure S1). Extracted DNA samples were digested by methylationsensitive restriction enzymes HpaII, blocked by CG methylation, and MspI, which blocked by external cytosine methylation. Both enzymes are unable to digest both cytosines methylation (full methylation). Six primers were used for amplification of the genomic DNA extracted from leaves of control and drought-stressed plants (Figure 1). Differentially Methylated DNA Sequences Analysis The obtained differentially methylated DNA fragments (DMFs) were sequenced (fasta sequences were mentioned at S2 file) and analyzed by NCBI BLAST (Table 2). The sequence analysis of selected differentially methylated DNA fragments revealed that five sequences, encoded as DMF3, DMF4, DMF13, DMF16, and DMF18, are homologous to intergenic regions, while DMF10 is similar to intragenic regions (Table 3). DMF3 was present only after digestion with restriction enzyme HpaII, which represents drought-induced CG methylation. DMF3 is located upstream of Protein DEHYDRATION-INDUCED 19 homolog 3 gene. Three differentially methylated DNA fragments are similar to lncRNA genes. DMF4 and DMF10 had internal and external cytosine methylation under non-stress conditions, which indicate the existence of DNA demethylation under drought stress. DMF13 had internal cytosine methylation under the control condition and was absent under drought stress. DMF10 overlapped with the second exon of loc103635457 (lncRNA gene), whileDMF4 and DMF13 are located downstream lncRNA genes. DMF18 was absent only after digestion with HpaII and MspI restriction enzymes, which represent internal and external cytosine demethylation under drought stress. DMF18 has located downstream nudix hydrolase 2 genes. The 2529 Int.J.Curr.Microbiol.App.Sci (2019) 8(8): 2527-2543 remaining twelve differentially methylated sequences are mapped to deep intragenic regions (at least 5kb away from a known gene) on the maize genome. Table.1 Sequences of the primers used for Amp PCR Primer Sequence (5' to 3') TGGACCGGTG P1 ACCCGGTCAC P2 CACCCGGATG P3 TCAGTCCGGG P4 CAGTGCCGGT P5 AGCCGGGTAA P6 Table.2 BLAST results of selected differential methylated fragments DMF Sequence location Expect Identities 1 2 3 4 5 Chr5:100,888,878- 100,889,347 Chr7:36,728,596- 36,728,988 Chr10:22,664,293- 22,664,724 Chr6:170,351,523- 170,352,219 Chr1:231,772,745- 231,773,253 0.0 8e-174 0.0 0.0 7e-125 459/470(98%) 375/395(95%) 431/432(99%) 654/703(93%) 428/513(83%) 6 7 8 9 10 11 12 13 14 Chr1:104,570,850- 104,571,365 Chr3:23,692,411- 23,692,839 Chr4: 4,364,531- 4,364,991 Chr5:181,065,261- 181,065,681 Chr8:81,740,729-81,741,408 Chr1: 293,813,390- 293,813,822 Chr5:43,804,361- 43,804,644 Chr10: 42,514,744- 42,515,321 Chr5:122,150,598- 122,151,218 0.0 0.0 0.0 0.0 0.0 0.0 3e-138 0.0 0.0 513/517(99%) 425/429(99%) 428/463(92%) 415/421(99%) 672/680(99%) 428/433(99%) 279/284(98%) 577/578(99%) 619/622(99%) 15 16 17 18 Chr1: 122,718,961- 122,719,349 5e-156 349/389(90%) Chr3:118,615,902-118,616,099 3e-46 163/199(82%) Chr5:152,126,082-152,126,663 0.0 544/582(93%) Chr9:100,692,230-100692689 7e-165 415/463(90%) DMF: Differential methylated fragment 2530 Int.J.Curr.Microbiol.App.Sci (2019) 8(8): 2527-2543 Table.3 Differentially methylated DNA fragments of maize inbred line W22 that show similarity to intragenic regions No 1 DMF 3 Status M Gene ID Description Position and Distance LOC100284110 Protein DEHYDRATION- 3' downstream (3474 bp) INDUCED 19 homolog 3 2 3 4 5 6 4 D LOC103630773 LncRNA 3' downstream (926 bp) 10 D LOC103635457 LncRNA Exon 2 13 D LOC103641044 LncRNA 5' upstream (3889 bp) 16 D LOC103652144 Uncharacterized 5' upstream (1084 bp) 18 D LOC100273780 Nudix hydrolase 2 3' downstream (3403 bp) DMF: Differential methylated fragments M: Methylation D: Demethylation Figure.1 Representative AMP PCR profiles of control (C) and stressed (S) plants. DNA extracted from the leaves of maize inbred line W22 was digested by either HpaII or MspI and amplified by using primer 1 (A), primer 2 (B), primer 3 (C), primer 4 (D), primer 5 (E), and primer 6 (F) (A) 2531 Int.J.Curr.Microbiol.App.Sci (2019) 8(8): 2527-2543 (B) (C) 2532 Int.J.Curr.Microbiol.App.Sci (2019) 8(8): 2527-2543 (D) (E) 2533 Int.J.Curr.Microbiol.App.Sci (2019) 8(8): 2527-2543 (F) Supplementary Materials Figure.S1 Represents control (left) and drought stressed (right) plants of the maize inbred line W22 2534 Int.J.Curr.Microbiol.App.Sci (2019) 8(8): 2527-2543 S2: Fasta sequences of the eighteen differentially methylated DNA fragments >DMF1 TCCGACTTCGATGCTCGAGTTTTTCAGCAAGATTGGACCGGTGGAGGACC CGCTTTGACTGATTCTATTGTACTTCAGCTTCGGTGATTTCCTTCTGTTT CTGGATTGTGACTTGACAGATTCTTGTTGTATGCCCCTTATCCTCTCCAT AGAAAAGGCAGAACATTTTCCTTGGTTGAGAGTTGAATCTTCCTCCGAAA CTCCTTCATCCTCTTCCACCTCTTGGAGTCGGTGGTCTGAACGTATTTTG CTGGGTTCATATGGATTGATAATGATTTTGTTGTGCCTCAATGTGACTGT CTTTGTTCTCGTTCTGATTTGAATTGTGTATGGTCCTGACATGCCTTGGA TTGAACCGTCCGCCGAAGCCCCTGGTCATCTCGGAATATCTCAAGGCCTC CTCTTTTCTTTGTCGAAAATCATTATTCACTCTGATATATTCATTCATCT TCTAGAGAAGCTTTTCCAGGGTCTGAGAGGGTTTCCTGGCGAAGTATTGT GGCACCGGTCCAATCTTTCTAGAAGATCTCCTACAATATTCTCAGCTGCC ATGGAAAATCGATGTTCTTCTTTTATTCTCTCAAGATTTTCAGGCTGTAT ATTAAAACTTATATTAAGAACTATGCTAACCACCTCATCAGGAACCGTTG TAGGTGGCGTGGGTTTTCTTGGCAATCGACTCTCATGAAAACTACGAGCT AAATATTCAATATGTTCCTCTTGACCAACTTTATTCTGCATTTTTTTTGA ACGAGGTTTAGAGCAAGCTTCAGGAAACTGAGACAGGAATTTTATTAAAA ATTTAAATTTTGAAGAAAGTTCAGGGTTAATAGCATCCATTTTTTGCTTT GCAAGTTCCTCAGCATTCTTAACAAAAGACGTCTCTTTTGACATGTTTAA AGTTTAAACC >DMF2 CCGCGTATTCCGGATGCTCGAGTTTTTCAGCAGATTGGACCGGTGAAGGT GAGTGCGGGGTGAAGTGGGGCGCGCTTCGGGGAGGCTTTATAGGCGCGAG CGAGCACGGCCGAGGGCGGGGCTCTGACATGCGCTCGGGGCGTGCACGAC GAACGCCAGTGCGCGCTCTGGCGCCTGGCACAGCGTCGAGCACGAGGCAG CGCAGAGAGAGGTCAAGTTCAAACGCGGTTTGGGCCCAAATCTTTGAGAT TAAGGCCACGATCCCGTTGAAAGATCTCTTCCTCTCAGGTCCCTTTGTCG TTTGTGTGTGGAGGCTAGCAAGTTTCGTTGACTGGATTAAGAGATAGAGA GGGGAGAAATCCTGTTTGTCTCACTGCCATACACAGGGAGAAAATCTCTG GTTTGACGTGTCCGAGGCACCGGTCCAATCTTTCTAGAAGATCTCCTACA ATATTCTCAGCTGCCATGGAAAATCGATGTTCTTCTTTTATTCTCTCAAG ATTTTCAGGCTGTATATTAAAACTTATATTAAGAACTATGCTAACCACCT CATCAGGAACCGTTGTAGGTGGCGTGGGTTTTCTTGGCAATCGACTCTCA TGAAAACTACGAGCTAAATATTCAATATGTTCCTCTTGACCAACTTTATT CTGCATTTTTTTTGAACGAGGTTTAGAGCAAGCTTCAGGAAACTGAGACA GGAATTTTATTAAAAATTTAAATTTTGAAGAAAGTTCAGGGTTAATAGCA TCCATTTTTTGCTTTGCAAGTTCCTCAGCATTCTTAACAAAAGACGTCTC TTTTGACATGTTTAAAGTTTAAACC >DMF3 CCGGAAATTCGGATGGCTCGAGTTTTTCAGCAGATTGGACCGGTGAGGCG ACCAGAGGGAGGGCGAATAGGAGCCACTAAAAATTCTCTTGCGAGAACAA CAACATGACTTGATTCCCAATTTAACCCAGAACCTCTAGGGACTCACAAA GCACCAGTTCACTGTGTAATTCAAACCATTGTCATTTGAATACACCAAAA 2535 Int.J.Curr.Microbiol.App.Sci (2019) 8(8): 2527-2543 ACCTAGGAGAGAAACAAACCAACTATCTACCAAAATCAGAGACAAAATCA TATAACAGAGGGCGCGAAAGTGCCGGGCACCAAAACTGAGGCAGATGTGC CTCAAACTTTGCAAAAGTTTGTGTGTGGAGAAAGATGTCTAGTAGTGAAG TATCAACCCAAGCAACACAAAAACCAAATCACAAATCAAAAATCTCATTT AGTGTGTGTTCTGCCAGTGAGTATTGCACCGTGTGCGTGTCCCTCACGTC CTAGAAATCTGTCCCACCGGACCAATCTTTCTAGAAGATCTCCTACAATA TTCTCAGCTGCCATGGAAAATCGATGTTCTTCTTTTATTCTCTCAAGATT TTCAGGCTGTATATTAAAACTTATATTAAGAACTATGCTAACCACCTCAT CAGGAACCGTTGTAGGTGGCGTGGGTTTTCTTGGCAATCGACTCTCATGA AAACTACGAGCTAAATATTCAATATGTTCCTCTTGACCAACTTTATTCTG CATTTTTTTTGAACGAGGTTTAGAGCAAGCTTCAGGAAACTGAGACAGGA ATTTTATTAAAAATTTAAATTTTGAAGAAAGTTCAGGGTTAATAGCATCC ATTTTTTGCTTTGCAAGTTCCTCAGCATTCTTAACAAAAGACGTCTCTTT TGACATGTTTAAAGTTTAAACC >DMF4 ATCATCCGAGTCGCATGCTCCGGCCGCCATGGCGGCCGCGGGAATTCCGA TTTACCCGGTCCACGTACTCCACATTGGCTTGCTGTCCGCATGCTTTACT CCGCCTCCTGCCTTTCCAGAAGCTAAGGATTTTACAAGGATTTCGTTTCA TCAAATCGTGAGGCCCATGCTGCAAGAAAGGAGGCCCATGCTGCAAGAGA TGAGGCGGTTGAGAGGCAGAGAAGGATGTAACGGCTGCGCTCCAAGAAAA TTGCAATCCATGAAAGAGGAAGGAAAAAAAACGGATAATGAGAAACGTGG CATCACAGGATTTCCATTCGCTCCAGTTTCGCGCACGATTCCGCAAATCT GGTTTCTTTTTGTCCGGTTTTCTTCGAAGGCTAATCGCTAAATCTGGACA GCAGTTTTGCCAAACCAGTTGAAAAGGACGTGGAGAACACATAGTACCAC TAAACCTCCTACATCCAGATGTGATACTGGATTTTTTTTCTTCGACAACA TACCCTACTGCGGTACTATTTGGTAACAAGTTGTGGCATAGAAAAGTTAC TGATGTGGGGAAAAAAAGTAGAGACATGTCTTCTTACTGATAATAATAGG CTGGGCCCCTCGCCCTCGGAAATTTGGATAAAGATGCATCTGTTATTTAC TGTGTTATTCAACTATTCAGCTCATTTGTTGGGATTAACATCGATTTGAT GTGCAGAAGCAGGTGATGATTTCTCCCTATCAGAGCTGATTTGGTGACCG GGTAATCACTAGTGAATTC >DMF5 AGAGGGGGAGTCGCATGCTCCGGCCGCCATGGCGGCCGCGGGAATTTCCG ATTTACCCGGTCCACGGATTGGTATTATAGGGACTTAGAAATCGATTCCT AGGCACCAAAGAATCTAACAATGGTATCAGAGCCATCCTAAGAACCCTAG ATCTCCTAATCTGCATCGGTTTCATGAGATCACAGGAAGGTCTCGGATAA ATGTGATTGAACTCATTTTTTTATCATTGTTCATCACCCGAGATCAGACA GATTAGAATATAAAGAAGTTTAGATCTCTCGATTTAGGGTTTTAACCTAA CCGTAGGGTTTTGGCCACTGACAGGCAAAACCCATGGAGTCCAAGATAGT AAAAATAGATCGACGTTTTAGGGTTAGGGTTTAATATGCTAACCCTAATC GGTTTTTAAACTGGGCCAATAGAAATCACAGTGGCCCGGGATCCAACGAT CCACGGCTAAGAAACAATCAAGAGGAAATAGAAACACAGATCGTGTTAGG GTTCTTTAACCGTAACCGATTTAACCCCAAAAACCGAATCAGTCAAAGTG CACTGTTCGTTTAGGTTCGGTGACCGGGTAATCACTAGTGAATTC 2536