Nội dung

Turkish Journal of Botany Turk J Bot (2015) 39: 982-987 © TÜBİTAK doi:10.3906/bot-1502-35 http://journals.tubitak.gov.tr/botany/ Research Article Development of AFLP markers associated with zucchini yellow mosaic virus resistance in cucumber (Cucumis sativus L.) 1,* 1 1 2 Hasan Özgür ŞIĞVA , Ahmet Fikret FIRAT , Gülden HAZARHUN , Ahmet İPEK 1 May-Agro Seed Corp., Bursa, Turkey 2 Department of Horticulture, Faculty of Agriculture, Uludağ University, Görükle Campus, Bursa, Turkey Received: 17.02.2015 Accepted/Published Online: 19.10.2015 Printed: 21.12.2015 Abstract: Zucchini yellow mosaic virus (ZYMV) is one of the most important pathogens that cause significant yield losses in many cucurbit crops including cucumber (Cucumis sativus L). ZYMV resistance in cucumber is inherited by a single recessive gene. The purpose of this study was to identify molecular markers linked to the gene conferring ZYMV resistance in cucumber. We developed a population of 188 F2 plants derived from inbred cucumber lines. Individual F2 plants were self-pollinated to generate F3 populations. Ten randomly selected plants from each F3 population were tested for ZYMV resistance. We used a bulk segregant analysis method to identify putative molecular markers linked to ZYMV resistance. Using bulked DNA samples with parental lines and F1, a total of 170 sequence-related amplified polymorphism (SRAP), 586 simple sequence repeat (SSR), and 308 amplified fragment length polymorphism (AFLP) primer combinations were screened. Neither polymorphic SRAP nor SSR markers were linked with ZYMV resistance. Among the 308 AFLP primer combinations tested, an AFLP marker in the E-ACA/MCA primer combination showed significant association among parental lines, F1, and resistant and susceptible plants. The combination of E-ACA/M-CA was achieved on parental lines, F1, and 188 F2 individuals for confirmation of the marker segregation on the F2 population. We found that the combination of E-ACA/M-CA was linked to the zym locus with 6.91 cM. Key words: Cucumber, Cucumis sativus L., zucchini yellow mosaic virus, molecular markers, AFLP, SSR, SRAP 1. Introduction Zucchini yellow mosaic virus (ZYMV) is one of the aphidborne viruses that was discovered in southern Europe 30 years ago (Gal-On, 2007; Amano et al., 2013). It is a member of the family Potyviridae and genus Potyvirus (Regenmortel et al., 2000). ZYMV is an important virus that causes significant damage and losses in cucumber yields (Provvidenti et al., 1984; Yuki et al., 2000; Park et al., 2004; Amano et al., 2013). This virus is transported from plant to plant by aphids. Especially in the late summer and early fall, aphid populations are increased due to favorable environmental conditions, and therefore virus epidemics in these seasons can be promoted (Kosaka et al., 2006; Amano et al., 2013). Due to the limitations in chemical, biological, and other plant protection methods for viral diseases in greenhouse cultivation, the most important plant protection method is to generate virusresistant cucumber cultivars. In cucumber, inheritance of the ZYMV-resistant trait has been characterized and derived from TMG-1 (Taichung-Mou-Gua) and Dina-1 (Dina). Both TMG-1 and Dina-1 inherited a recessive allele at a single locus, zymTMG-1 and zymDina-1 * Correspondence: hasansigva@gmail.com 982 (Providenti, 1987; Abul-Hayja and Al-Shahwan, 1991; Kabelka et al., 1997; Park et al., 2004; Amano et al., 2013). Transfer of the recessive resistance gene into susceptible cultivars is time-consuming, laborious, and costly, and the only way to overcome these problems is the use of molecular markers. Park et al. (2004) developed sequence characterized amplified region (SCAR) and cleaved amplified polymorphic sequence (CAPS) markers that were linked to the zym locus. However, these markers may not segregate in all resistant and susceptible lines, making them unusable for marker-assisted selection. Recently, Amano et al. (2013) also developed both CAPS-T86C and dCAPS-G99A molecular markers that were linked to the zym locus. Many simple sequence repeat (SSR) and sequencerelated amplified polymorphism (SRAP) markers have been developed and used for the development of highdensity genetic maps and for whole-genome analysis and identification of candidate genes for the important traits in cucumber (Li and Quiros, 2001; Ferriol et al., 2003; Yeboah et al., 2007; Fukino et al., 2008; Watcharawongpaiboon and Chunwongse, 2008; Hu et al., 2010; Li et al., 2011; Meng et ŞIĞVA et al. / Turk J Bot al., 2012; Amano et al., 2013). Several amplified fragment length polymorphism (AFLP) primer combinations were also used for wide genome analysis and identification of candidate genes in cucumber (Park et al., 2000; Witkowicz et al., 2003; Bae et al., 2006). The purpose of this study was to determine additional molecular markers linked to the ZYMV resistance gene in cucumber (Cucumis sativus L.) using SRAP, SSR, and AFLP markers. 2. Materials and methods 2.1. Plant material In order to develop mapping populations, a ZYMVresistant inbred line, BTL_HTP_1, and a susceptible inbred line, BTL_HTP_2, were used as parental lines. These parental lines were obtained from the May-Agro Seed Corp. cucumber breeding program. Both resistance and susceptibility of parental lines to ZYMV were assessed using pathogenicity tests (Yardımcı and Korkmaz, 2004). A single resistant plant from BTL_HTP_1 as a female and a single susceptible plant from BTL_HTP_2 as a male were crossed to generate F1. Single susceptible F1 plants were self-pollinated to generate an F2 population with 188 plants. Each F2 plant was self-pollinated to develop 188 F3 populations. Ten plants from each F3 population were tested for resistance to ZYMV to determine the genotypes of the F2 plants. 2.2. Virus maintenance, storage, inoculation, and detection procedure ZYMV virus inoculants were tested and stored at –80 °C in a freezer (Thermo Scientific REVCO Value Series, Waltham, MA, USA) until use at May-Agro Seed Corp. ZYMV virus inoculum was prepared by grinding infected cucumber leaves according to Yardımcı and Korkmaz (2004). To determine the genotype of F2 plants, 10 randomly selected plants from each F3 population were planted in a mixture of 70% peat and 30% perlite. Ten days after planting, carborundum-dusted cotyledons of 10-dayold seedlings were mechanically inoculated by a sponge dipped in inoculum solution. After inoculation, all of the inoculated plants were kept in a growth chamber for one night under high humidity (85%–90%) and transferred to a greenhouse the next day. All plant materials were kept at 25 °C with a 16/8 h light/dark photoperiod. Two weeks after inoculation, all of the inoculated plants were scored as 1: no symptoms, 3: slight mosaic limited to lower leaves, 5: clear mosaic on lower leaves and slight mosaic on upper leaves, 7: moderate mosaic on upper leaves, or 9: severe mosaic on all leaves. Parental lines were included in the analysis as resistant and susceptible controls. After the calculation of disease severity index (DI = Σ[(s × n)/(S × N)] × 100, where s = disease rating scale, n = number of plants with each disease rating, N = total number of plants, S = highest disease rating scale), scores of 3.0 or less were considered as resistant and scores greater than 7.0 were considered as susceptible. Results between 3.0 and 7.0 were considered as heterozygous genotypes. After morphological evaluation, ZYMV virus detection was performed using double-antibody sandwich enzymelinked immunosorbent assay (DAS-ELISA) methods developed by Clark and Adams (1977). DAS-ELISA was carried out according to the manufacturer’s protocol (Agdia Inc., Elkhart, IN, USA). All of the measurements were performed at 405 nm wavelength in an ELx808 microplate absorbance plate reader (BioTek Instruments Inc., Winooski, VT, USA). Healthy plants (as a control), a negative control, a positive control, and buffer were used for every test. All samples were regarded as positive if the measurement was more than twice that of the control healthy plants. One month after this measurement, all analyses were replicated for a double-check. 2.3. Molecular analysis 2.3.1. DNA isolation All of the DNA was isolated from leaves of the plants at the 3–4 true leaf stage with the DNeasy Plant Mini Kit (QIAGEN, Limburg, Netherlands) using the manufacturer’s protocol. DNA concentrations of all samples were measured quantitatively and qualitatively with a spectrophotometer (Eppendorf Biophotometer Plus, Hamburg, Germany) at A230, A260, and A280 wavelengths. The isolated DNAs were stored at –20 °C. 2.3.2. SRAP analysis A total of 17 forward (ME) and 10 reverse (EM) previously tested SRAP primers were selected for genotyping analysis (Li et al., 2001; Ferriol et al., 2003; Yeboah et al., 2007; Meng et al., 2012). PCR amplification of DNA with ME and EM primer combinations was carried out according to the protocol described by Ferriol et al. (2003). Each PCR reaction of 25 µL contained 1X PCR buffer, approximately 50 ng of template DNA, 0.3 µM of each forward and reverse primer, 200 µM dNTP, 1.5 mM MgCl2, and 1 U of Taq DNA polymerase (Fisher Scientific, Pittsburgh, PA, USA). All PCR amplifications were carried out using a C-1000 thermal cycler (Bio-Rad Inc., Hercules, CA, USA) and the following thermal cycling conditions: 5 min at 94 °C; 5 cycles of 1 min at 94 °C, 1 min at 35 °C, and 2 min at 72 °C; and 30 cycles of 1 min at 94 °C, 1 min at 50 °C, 5 min at 72 °C. The PCR products were fractionated on 3% Super Fine Resolution (SFR) agarose gel, stained with EtBr, and visualized on a gel documentation system (BioRad Inc.). All SRAP primer combinations are given in Supplementary Table 1 (on the journal’s website). 2.3.3. SSR analysis A total of 586 previously developed primers of SSR markers were selected for genotyping analysis (Watcharawongpaiboon and Chunwongse, 2007; Fukino 983 ŞIĞVA et al. / Turk J Bot et al., 2008; Hu et al., 2010). Each PCR reaction contained 1X reaction buffer, approximately 50 ng of template DNA, 0.5 µM of each forward and reverse primer, 200 µM of each dNTP, 1.5 mM MgCl2, and 1 U of Taq DNA polymerase (Fisher Scientific). All PCR amplifications were carried out in a C-1000 thermal cycler (Bio-Rad Inc.) using the following thermal cycling conditions: 3 min of initial denaturation at 94 °C; 36 cycles of 30 s of denaturing, 45 s of annealing at 50–60 °C, and 1 min of elongation at 72 °C; and a final elongation step of 5 min at 72 °C. The PCR products were fractionated on 3% SFR agarose gel and stained with EtBr. PCR products were visualized on a gel documentation system (Bio-Rad Inc.). All SSR primer sequence information is given in Supplementary Table 2 (on the journal’s website). 2.3.4. AFLP analysis AFLP analysis was carried out according to the protocol described by Vos et al. (1995) with the modifications of Park et al. (2000). A total of 308 primer combinations were selected for genotyping analysis. All AFLP primer combinations are given in Supplementary Table 3 (on the journal’s website). AFLP products were visualized on the 4300L DNA Analysis System (LI-COR Inc., Lincoln, NE, USA). 2.3.5. Bulk segregant analysis Bulk segregant analysis was performed with the protocol described by Michelmore et al. (1991). The genotypes of all F2 plants were determined via pathogenicity test as susceptible, resistant, and heterozygous. DNA from 20 homozygous susceptible (BS-1 and BS-2) and 20 homozygous resistant (BR-1 and BR-2) plants was pooled for preparation of ZYMV-susceptible and ZYMVresistant bulks, respectively. In total, 170 SRAP primer combinations, 586 SSR primers, and 308 AFLP primer combinations were selected for genotypic screening in order to find any polymorphisms between susceptible and resistant bulk groups as well as the resistant parent BTL_HTP_1, the susceptible parent BTL_HTP_2, and F1. Polymorphic primer combinations were used on all F2 progenies and compared with phenotypic data to calculate the distance between the zym locus and the candidate marker. 3. Results 3.1. Phenotypic and serological analysis of ZYMV Two weeks after ZYMV inoculation, all of the inoculated plants were scored with resistant and susceptible parental lines. After calculation of the disease severity index, 3.0 or less was considered as resistant and greater than 7.0 was considered as susceptible. Between 3.0 and 7.0 was considered as still segregating. Healthy plants and plants with slight and severe mosaic symptoms are shown in Figures 1a–1c. According to phenotypic observation 984 results in F3 populations, 39 F2 plants were homozygous resistant, 52 F2 plants were homozygous susceptible, and 97 F2 plants were heterozygous. According to DAS-ELISA analysis, 46 F2 plants were resistant homozygous, 51 F2 plants were susceptible homozygous, and 91 F2 plants were heterozygous. According to the chi-square test, phenotypic and DAS-ELISA results fit a genetic segregation ratio of 1:2:1, confirming the previous results that ZYMV resistance was inherited by a single recessive gene (Providenti, 1987; Kabelka et al., 1997; Park et al., 2004; Amano et al., 2013). Phenotypic and serological analyses of ZYMV resistance in the F2 population are shown in Table 1. 3.2. Molecular analysis 3.2.1. Bulk segregant analysis After phenotypic and serological analysis, all of the F2 genotypes were determined as susceptible, resistant, or heterozygous. DNA from 20 homozygous susceptible (BS1 and BS-2) and 20 homozygous resistant (BR-1 and BR-2) plants was pooled for preparation of ZYMV-susceptible and ZYMV-resistant bulks, respectively. 3.2.2. SRAP analysis A total of 170 SRAP primer combinations were screened using resistant and susceptible parental lines with F1 and resistant and susceptible bulk DNA samples. There were 760 DNA bands amplified with 170 SRAP primer combinations. Approximately 8.95% (68) of these DNA bands were polymorphic. However, none of these polymorphic SRAP markers were linked to ZYMV resistance. 3.2.3. SSR analysis A total of 586 SSR markers were also screened using resistant and susceptible parental lines with F1 and resistant and susceptible bulk DNA samples. Among the 586 SSR markers, only 52 SSR markers (8.87%) were polymorphic and there was no correlation between ZYMV resistance and polymorphic SSR markers. 3.2.4. AFLP analysis A total of 308 AFLP primer combinations were screened using the same DNA samples. Among the 308 AFLP primer combinations tested, the combination of E-ACA/ M-CA showed expected segregation on both parental lines, F1, and bulk groups. AFLP primer combinations of E-ACA/M-CA are shown in Figure 2 with their segregation on the parental lines, F1, and bulk groups. The E-ACA/MCA primer combination was tested on parental lines, F1, and 188 F2 individuals in order to calculate the genetic distance between the marker and the zym locus. We found that the combination of E-ACA/M-CA showed 93.08% correlation with phenotypic data. We thought that the combination of E-ACA/M-CA was linked to the zym locus with a distance of 6.91 cM. ŞIĞVA et al. / Turk J Bot a b c Figure 1. Healthy plants (a) and plants with slight mosaic (b) and severe mosaic (c) symptoms on cucumber leaves. Table 1. Phenotypic and serological analysis of ZYMV resistance in F2 population. Number of observed plants Population Total plants F2:3 (phenotypic observation) F2:3 (DAS-ELISA results) Positive Expected ratio χ2 97 52 1:2:1 0.369 91 51 1:2:1 0.795 Negative Negative/ positive 188 39 188 46 4. Discussion ZYMV is one of the most important virus diseases in cucumber. It causes significant amounts of yield loss in greenhouse cultivation (Provvidenti et al., 1984). ZYMVresistant cucumber cultivars have been developed by using conventional breeding methods. Pathogenicity testing in conventional breeding is time-consuming, laborious, and more expensive. In addition, pathogenicity testing can easily be affected by the environment. Due to the recessive inheritance of the zym locus in cucumber, test crosses are required after every backcross of conventional breeding in order to determine the progeny carrying the recessive resistance gene (Purcifull et al., 1984; Amano et al., 2013). Therefore, development of DNA-based molecular markers and use of them in marker-assisted selection breeding is critical to increase efficiency of ZYMV-resistant breeding in cucumber. In marker development studies, it is necessary to characterize phenotypes of the segregating population. In our study, out of 188 F2 plants, 39 were homozygous resistant, 97 were heterozygous, and 52 were homozygous susceptible in phenotypic observation; however, in DAS- 985 ŞIĞVA et al. / Turk J Bot Figure 2. Polyacrylamide gel showing amplicons. M, male; F, female; F1, from BR1 to BR6 and from BS1 to BS6 screening with E-ACA/M-CA. ELISA analysis, 46 were homozygous resistant, 91 were heterozygous, and 51 were homozygous susceptible. This discrepancy between phenotypic and DAS-ELISA results is probably due to the sensitivity of the DAS-ELISA method compared to phenotypic observation. ZYMV is inherited by a recessive allele at a single locus, zymTMG-1 and zymDina-1 (Kabelka et al., 1997; Park et al., 2004; Amano et al., 2013). According to our phenotypic evaluation results, we confirmed that ZYMV resistance is conferred by a single recessive locus. Bulk segregant analysis is an effective and rapid procedure to identify the gene(s) of interest in segregating populations. This method has been used for both monogenic qualitative traits and quantitative trait loci (Michelmore et al., 1991; Collard et al., 2005). Besides, this method allows rapid and convenient molecular screening of the bulk groups. We developed an AFLP marker that linked to the zym locus in our cucumber breeding material with 6.91 cM. Park et al. (2004) developed a linked DNA-based molecular marker for the zym locus in cucumber. However, this marker did not segregate in any of our 42 inbred cucumber lines. Amano et al. (2013) also developed other CAPST86C and dCAPS-G99A CAPS markers derived from RFLP markers for the zym locus. In this study, the combination of E-ACA/M-CA was linked with the zym locus and showed the correct correlation of the F2 population with parental lines and F1. Because of some restrictions of AFLP methods, it is necessary to convert SCAR markers to use for markerassisted selection in breeding. This marker will be converted to a SCAR marker in a future study. Acknowledgments The authors would like to special thank Dr Geoffrey Lloyd Thomas for his valuable scientific support. This research was supported by the Scientific and Technological Research Council of Turkey (TÜBİTAK, project no. TEYDEP/3120013) and the May-Agro Seed Corporation. References Abul-Hayja Z, Al-Shahwan I (1991). Inheritance of resistance to zucchini yellow mosaic virus in cucumber. J Plant Dis Prot 98: 301–304. Amano M, Mochizuki A, Kawagoe Y, Iwahori K, Niwa K, Svoboda J, Maeda T, Imura Y (2013). High-resolution mapping of zym, a recessive gene for Zucchini yellow mosaic virus resistance in cucumber. Theor Appl Genet 126: 2983–2993. Fukino N, Yoshioka Y, Kubo N, Hirai M, Sugiyama M, Sakata Y, Matsumoto S (2008). Development of 101 novel SSR markers and construction of an SSR-based genetic linkage map in cucumber (Cucumis sativus L.). Breed Sci 58: 475–483. Gal-On A (2007). Zucchini yellow mosaic virus: insect transmission and pathogenicity—the tails of two proteins. Mol Plant Pathol 8: 139–150. Bae KM, Kwon YS, Cho IH, Yi SI (2006). Use of cDNA-AFLP for transcript profiling in narrow genetic pools; for example, cucumber (Cucumis sativus L.). Plant Breeding 125: 488–492. Hu J, Li J, Liang F, Liu L, Si S (2010). Genetic relationship of a cucumber germplasm collection revealed by newly developed EST-SSR markers. J Genet 3089: 28–32. Clark MF, Adams AN (1977). Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J Gen Virol 34: 475–483. Kabelka E, Ullah Z, Grumet R (1997). Multiple alleles for zucchini yellow mosaic virus resistance at the zym locus in cucumber. Theor App Genet 95: 997–1004. Collard BCY, Jahufer MZZ, Brouwer JB, Pang ECK (2005). An introduction to markers, quantitative trait loci (QTL) mapping and marker-assisted selection for crop improvement: the basic concepts. Euphytica 142: 169–196. Kosaka Y, Song RB, Kobori T, Shiomi H, Yasuhara H, Kataoka M (2006). Effectiveness of an attenuated zucchini yellow mosaic virus isolate for cross-protecting cucumber. Plant Dis 90: 67– 72. Ferriol M, Picó B, Nue F (2003). Genetic diversity of a germplasm collection of Cucurbita pepo using SRAP and AFLP markers. Theor Appl Genet 107: 271–282. Li G, Quiros CF (2001). Sequence-related amplified polymorphism (SRAP), a new marker system based on a simple PCR reaction: its application to mapping and gene tagging in brassica. Theor Appl Genet 103: 455–461. 986 ŞIĞVA et al. / Turk J Bot Li Y, Yang L, Pathak M, Li D, He X, Weng Y (2011). Fine genetic mapping of cp: a recessive gene for compact (dwarf) plant architecture in cucumber, Cucumis sativus L. Theor Appl Genet 123: 973–983. Meng H, Chen S, Cheng Z, Chai D, Li Y (2012). SRAP markers for fruit shape in cucumber. Pak J Bot 44: 1381–1384. Michelmore RW, Paran I, Kesseli RV (1991). Identification of markers linked to disease resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. P Natl Acad Sci USA 88: 9828–9832. Regenmortel MH, Mayo MA, Fauquet CM, Maniloff J (2000). Virus nomenclature: consensus versus chaos. Arch Virol 145: 2227– 2232. Vos P, Hogers R, Bleeker M, Reijan M, van de Lee T, Hornes M, Frijters A, Pot J, Peleman J, Kuiper M et al (1995). AFLP: A new technique for DNA fingerprinting. Nucleic Acids Res 23: 4407–4414. Watcharawongpaiboon N, Chunwongse J (2008). Development and characterization of microsatellite markers from an enriched genomic library of cucumber (Cucumis sativus L). Plant Breed 127: 74–81. Park Y, Katzir N, Brotman Y, King J, Bertrand F, Havey M (2004). Comparative mapping of ZYMV resistance in cucumber (Cucumis sativus L.) and melon (Cucumis melo L.). Theor Appl Genet 109: 707–712. Witkowicz J, Urbańczyk-Wochniak E, Przybecki Z (2003). AFLP marker polymorphism in cucumber (Cucumis sativus L.) near isogenic lines differing in sex expression. Cell Mol Biol Lett 8: 375–381. Park YH, Sensoy S, Wye C, Antonise R, Peleman J, Havey MJ (2000). A genetic map of cucumber composed of RAPDs, RFLPs, AFLP markers and loci conditioning resistance to papaya ringspot and zucchini yellow mosaic viruses. Genome 43: 1003–1010. Yardımcı N, Korkmaz S (2004). Studies on spread and identification of zucchini yellow mosaic virus disease in the north-west Mediterranean region of Turkey by biological indexing and double-stranded RNA analysis. Plant Pathol J 3: 1–4. Provvidenti R (1987). Inheritance of resistance to a strain of zucchini yellow mosaic virus in cucumber. Hort Science 22: 102–103. Yeboah MA, Xuehao C, Feng CR, Liang G, Gu M (2007). A genetic map of cucumber (Cucumis sativus L.) combining SRAP and ISSR markers. Afr J Biotechnol 6: 2784–2791. Provvidenti R, Gonsalves D, Humaydan H (1984). Occurrence of zucchini yellow mosaic virus in cucurbits from Connecticut, New York, Florida, and California. Plant Dis 68: 443–446. Purcifull DE, Adlerz WC, Simone GW, Hiebert E, Christie SR (1984). Serological relationships and partial characterization of zucchini yellow mosaic virus isolated from squash in Florida. Plant Dis 68: 230–233. Yuki VA, Rezende JAM, Kitajima EW, Barroso PAV, Kuniyuki H, Groppo GA, Pavan MA (2000). Occurrence, distribution, and relative incidence of five viruses infecting cucurbits in the state of Sao Paulo. Plant Dis 84: 516–520. 987 ŞIĞVA et al. / Turk J Bot Supplementary Table 1. SRAP primer combinations used for SRAP screening of parental lines and F1, BR, and BS groups. Forward primers, sequence of primers (5’-3’) Reverse primers, sequence of primers (5’-3’) ME1 TGAGTCCAAACCGGATA EM1 GACTGCGTACGAATTAAT ME2 TGAGTCCAAACCGGAGC EM2 GACTGCGTACGAATTTGC ME3 TGAGTCCAAACCGGAAT EM3 GACTGCGTACGAATTGAC ME4 TGAGTCCAAACCGGACC EM4 GACTGCGTACGAATTTGA ME5 TGAGTCCAAACCGGAAG EM6 GACTGCGTACGAATTGCA ME6 TGAGTCCTTTCCGGTAA EM8 GACTGCGTACGAATTCTG ME7 TGAGTCCTTTCCGGTCC EM9 GACTGCGTACGAATTGAT ME8 TGAGTCCTTTCCGGTGC EM14 GACTGCGTACGAATTCAG ME9 TGAGTCCAAACCGGAGG EM18 GACTGCGTACGAATTCCT ME10 TGAGTCCAAACCGGAAA EM20 GACTGCGTACGAAATTCTT ME11 TGAGTCCAAACCGGAAC ME12 TGAGTCCAAACCGGTAG ME13 TGAGTCCAAACCGGCAT ME14 TGAGTCCAAACCGGTCT ME21 TGAGTCGTATCCGGTCT ME22 TGAGTCGTATCCGGAGT ME23 TGAGTCGTCTACGGTAG 1 ŞIĞVA et al. / Turk J Bot Supplementary Table 2. SSR primer sequences: linkage and position used for SSR screening of parental lines and F1, BR, and BS groups. SSR marker name Forward primers, sequence of primers Reverse primers, sequence of primers Linkage Position CSN084 TCCTTTGTCACTCACTGTGCTTCC TGTTGCAGAGGGAAGCATCTTTTT 6 72.2 CSN051 ATCAACGATTGATCCATCACCATC AAGACTTGACCACATGCATGGAAA 6 68.7 CMBR41 GTACCGCCTAGGGTTTCTCC CGAGGAAGAGAGAGAAGGGG 6 37.1 SSR3411 GTTGGAGTCGTGGAGAGAGC ATTTGAAGGGAGACGTGTGG 1 42.3 SSR4278 GAGGGAAGAAAATTGAAAGCAA CCGATAGTGTCAGCCCACTT 1 41.3 CU421 AAATCCACCTCTTCGTTGGA GGGTGATACAAGGAGCGAAG 1 0 CS27 GCTGAGTTATGGGGAAAGCA ATGTTGTTGGACCCCTTCAA 1 73.3 SSR1737 GATGATGATGGTCATCGTGG TCAAAGGATGGAAGAGGTGG 1 77.8 SSR1115 ATTCCCAATCCCAAAAAGGT CTCCTCCTCCAATGAGCAAG 1 19.8 SSR1091 CTCATCTCCGAACTCCCAAC TGGTAACAAGGTGGATCGAA 1 70.4 CMN21_55 TCATTGATCTTTTGCTTTTGC TGGTAGCAAACATCTGCCTG 1 38 SSR262 CCGTTGGTCTTGGACTCTCA TGTAAAAGTGATCAGGAGGGTCT 1 89.8 SSR190 TTCTGAAACGACACCTCCAG TCCCCTTCTAATTTACCTTCCA 1 4.8 CSJCT662 ACGTCGTAAAACCATCGGAGTC GCTTCCAAGCGTCAAAGGTATC 1 40.8 SSR231 GAGGTTGGGAAATTGGGAAT TATTCAAACACAAAGCCCGC 1 58.2 SSR10134 CCAAAACCAAAAGCAAAATCC AAATTTGCCAGGAACACCAG 1 29.2 CU84b GGATTCGACTGTCTCAACCG CATCATGCCATTTCATCGAC 1 3.4 SSR5793 CCCTCTGCTGCACATTATCC TGCACCAAGCAATAACTTGTC 1 5.3 SSR5723 TGGCTTTTCTGTCACGTCC TCCATGGTACAACAAGAATCACA 1 81.8 CU742 TGCTTTTCAGTACCTCCCTCA GGAAGAGCTGCCACTGCTAC 1 45.9 SSR5124 TCTTTACCAATTTTATGGTGATGTT AATCAAGGGTGCAAATGTCA 1 24.6 GCM206 TGGGCTACCTCTATCCTTTCTT AATCCCCAAAATCTCAACCA 1 96.6 SSR3222 TCCACAGTCTTGCATTTGCT ATCCCCTCGATTCACATCAA 1 96.6 SSR479 GGACGCCACGATTCTACAAG GGATGTTCGAGTTGCAGACC 1 97.5 SSR2733 TTGTTAGGTAAGCCATGCCC TTTGCCTGAGGAAGAATCTGA 1 72.8 CU1680 CCCACCGTTATCCTCATTTC AGAAGGCAAAGGCAAATTCA 1 17.4 SSR2734 TGTTGTTGGACCCCTTCAAT TGTCAAAGGAGGAGGTGGAG 1 72.8 SSR160 TGAATGAAAAACGTGATGTTGA TTGGAAAAGCCTCTCATTCG 1 12.6 CMN21_88 CAGTCCTCCCCTTCTTCTCC TCAGTCGCAACAGCAAGAAC 1 0 CSN135 ATTCGATCTCTATATTTTACTCC CACAATGTTTGACATATAGAC 2 70.6 CMBR103 TGGTTGAGGAAGACTACCATCC TCCACTAAAGTTTCCTTATGTTATGG 2 55.8 CMBR83 CGGACAAATCCCTCTCTGAA GAACAAGCAGCCAAAGACG 2 55.8 CMBR95 TTGACCTTTTACGGTGGTCC CGGACAAATCCCTCTCTGAA 2 55.8 CSWCT04 ACTATTGGGTCTCTCCTA GACCCGAGGTTATTATT 2 55.8 CMTC160A+b GTCTCTCTCCCTTATCTTCCA GATGGTGCCTTAGTTGTTCCG 2 46.4 CSN310 AAAATTGCCCAGTATGTGTTT TGCATCTATACTTTGTCAAGTC 2 42.1 CSN242 TCCTTTTATACCACTAGGTCAACCCAT ATAGCCTGACCATCTAATCGCCAA 2 32.9 GCM295 CCTATGTGCTTCCTTCAATCA CGCATAATTCAATGAAAATGAGT 2 22 CSWCTT02D CATCCTCATTCATGGCGGAGTGTG GAATTTGTTAAAAATGTACATTAA 2 5.2 CSN052 ATGGGTTTCCAAATGTTTGTCTCG CATCTCCATGCATTCCACTCTCAT 2 2.3 SSR30 TGAAATTGCTTACCCTTTGACC CCATGTTTTGTAGGGATCGAG 2 41.6 2 ŞIĞVA et al. / Turk J Bot SSR1286 CCGAAAACCATTGTTCAAGC TTTAGCTTAGTTTCCAAGCACTGA 2 57.7 SSR1253 CGCTGGATTTGTTTGTGAAAT AATGTCGGGGAGTGTCACAT 2 89.9 CU1594 CTACACCGGCGGACATTACT GAGCGAAGAATGAGAGGTGG 2 5.2 SSR1374 GGGAGATTCTCAAAATGGATGA TTGCGTGTAAGGAACGTCAC 2 37.3 CU1817 GAAACTCCAAGGAACCCCTC TGCATTGTCTGGTGATCCAT 2 94.6 SSR4035 TCCGCTTCGAGTACGCAT ACAAGAATGCTGGAGATGGC 2 55.8 SSR218 CGATCTTCGAGTTTCGCAAT ATCCAACGGCTCTCATTCAC 2 51.3 CU1458 GCTCTGTTCCTTAGGGAGGG GGGGTTTTGGTTTTTGGTTT 2 4.7 SSR3610 GGGGAAATACGTGAAAGAGG GGTCAAATGTCAAAGAGCGG 2 18.1 ECM92 SSR2634 TCAGACTCCATTTCAGAGCCTA CAAGGAGCTCTCCCCATTATT 2 40.2 GGGTTTGTGACACGTTTCCT GGCAAAGGCAACAAGTTTCT 2 65.3 SSR11596 TCACATAGGCTTGCTCCAAA TCAAACACCGCGAAAGAGAT 2 48.4 CU2297A TTCATATTCTAGTGTCAGCCAAACA TGAGTGGTGAGGGATTCACA 2 105.8 CU2239b TTTCTTCTTCGCAGTCACCA AGGTCAGCCCCAAATTCTCT 2 55.3 SSR5748 TGTGGCCTGTGCTAAAATGA TTTGGAAAAGCTAAAGCCCA 2 0 SSR204 AACCCTATTTGCACGCATTC GAGAAACAGCTGGAATTGGG 2 20.1 SSR3084 GACAAGGGATTCATCCGAGA CAGACCCTGAAGCGGATAAA 2 9.9 SSR289 AGGACGAGGCTAATGGGAGT TTACAAGTCCCCCTCAAACG 2 25.5 SSR10874 CTGGTTATAAATTCTGATGGTGATT ATGCTGCCATGTTACTCGTG 2 78.9 ECM115 TTCCACATGTCTCTGCCAAA TAGCCGGTGGAAATGGATTA 2 17.1 SSR6722 TCTCGTTTATGTGGATTAGTCGAG TATGTTCACCCAATGCTCCA 2 72.7 CMCTN2 CTGAAAGCAGTTTGTGTCGA AAAGAAGGAAGAGGCTGAGA 2 13.5 SSR10522 TTCCTTTTGTTTTTGGTATGGG ATGTCTGCTTTGCTGGCTTT 2 55.3 SSR11468 CCGTTTCACCGCTCATTTTA TCACAAGTGGCCAAAACAAA 2 63.4 CSN257 TGGAGAAAAAGAAGAAGTGGGTGA CAAGTGGGTCGTGAATTTTGTTTAG 2 0.9 CSN076 ATCTATAATACTACATGCACAC AATTGCACTTACAATGAGA 5 18.4 ECM80 CGTCCCCTTGTTACTACCTCA AAATCCTCCCTACATATATTATGCAAT 3 17.8 SSR2736 AATCCACTCCACAGGCTCAC CGTAGAGAAGCGCCTTGGTA 3 60.6 SSR3049 AGAGAAGAGTGCAACCAATGC TGTACGATCTTGTGGCTAGAGAA 3 0 SSR3056 TTGCCTGTCACATGATCAAAA TGCCTTCCATGTAAAAGCAC 3 84.5 ECM53 CTACCAGTTGTTGCGGCTCT TCCCAATTCCATAGCAGAGG 3 68.4 SSR2132 CAATTGGTATGAGTGAAAGATAAGC CTCTGGTCCACCCAATCCT 3 61.7 SSR33797 GACCCATGGGGTTATCAGAA TCTTGATGGCCGATCTATCC 3 68.9 SSR5012 GCCCTAGGCTTCGTCTTCTT TTCTACAACTGGCCAAACCC 3 107.1 CMN21_33 ATTCTTCAACAAGCCATCCG GGAAATTAGCACCAAGCGAA 3 96.7 SSR5572 GCAAACCATAAGTTTCCCCA GATCGATATTGCAACGAATTACA 3 85.5 CU832 CGTGTTTTCTCAGATTTCCCA CACTTCCCTTATCAACCCCA 3 85.5 SSR5891 GTTTGGGTATAGGGAGACCG TGAGATGTCGAGAACTCCATACA 3 22.9 SSR6210 TTGGAAAAGTCGCCAAACTT TCCATGTCTGCTTTTGATTCC 3 59 SSR10282 GGCACTCATTTCGGTTGACT CACGGACACAAATCACAATG 3 103 SSR1056 AAAGGGAAAGGTAAATTGCCA AGCAGTTCGGATGATATTGGA 3 77.2 CSN209 CCTGAACACAAATCTAAAAGAGCAGGA AGCATAAGCCTACGACCTACGGGT 3 62.2 SSR7505 GACAGGACCGTTAACCCAAA CTCCCTCTTTCCCTCACTCC 3 67 ECM134 TCTTTCCTCTGCAAATCCTTCT TGCTAAAGCTACATGCTGTCCT 3 81.3 3 ŞIĞVA et al. / Turk J Bot 4 TJ10 ACGAGGAAAACGCAAAATCA TGAACGTGGACGACATTTTT 3 23.4 SSR2008 TTGTCCTGGAAATTGGTGAA GGTGGGAAGTTTGTAAATGAGAA 3 69.8 CMBR153 TCAAAGACAAGAAGACCAACCA TGTGCTAAGAGAGAGAGAGAAGATTG 3 72.2 CMBR43 AGAGATGCTCCCTACACTGC TCAAGCAAACCCTAATCGGT 3 87 CMBR57 GCTCTGAAGAGTGGAATGAGAGA CCATTTGGGAAGTAGGCATC 3 98.2 CMN61_14 TGCAGGATCAAGAATCAAGTTC ACGAACTCCGGCATAATCAC 3 2.9 CSN002 AAAATGGGAAAAGTGGA GCCTTAACTAAATGACAAA 3 5.4 CSN018 TGTCTTTCCCTCAAACTACACCCC CCAAATGGGGTTCAACAAAGAAAC 3 94.7 CSN069 GATGTATGCTTATTTATACCCAA AGAAAATTAATCAAGACCTCTC 3 86 CSN147 CCACCCAACCAAAAAGCAGTAAAC GATGGGAGCAAATGTTGGTTTTGT 3 77.7 CSN153 TGGGTTTGCACACTCAAGAGAAAG AACATGAGAGTTCTCTTGCCCACC 3 49.4 CSN160 GTAGCAGAAGCCTCACCGGAGTAA CTTGTAGCAGAAGGCTTCCACGTT 3 2.3 CSN161 GTCCTTTCTGCCATTTTCTTGGGT CCCAAATTTAGTGGCTTCAACATCA 3 36.4 CSN166 CGTTCCTTCCCACTCTTCACATTT TTTGATGATGATGATGATGAGCCG 3 27.4 CSN171 TGCACAACAGTGTTTAGCTTGATGA TGAAGCCGAAGTAGATGAGACCTTC 3 55.6 CSN191 TAGATTTTTCATGAAGGGCGTTGG CGTCATTGTGACTGGAGGTAGCAT 3 22.9 CSN201 TCAACTTACACACACCCACACAAAA GTGGTTCGTCATTCCAGTTTATTTG 3 109.1 CSN251 ACCGACAAGCAGAGAGAAGAAAGC ATTTGGACTCATTTTGAGCACCGT 3 17.8 CSN284 AGCACCCCGGTATTTCTCTTTGAT TAAAGAGGCGAAAAGTTCGGAAGC 3 31.9 CSN306 TTTCCTCCCCTTTCCTTCATTCTC CAACCCAAATGCTTAGAGAACCCA 3 90.3 GCM246 AAAACGGAGATGTGGAGGAC TTAAGCAAGCAGCCAAAATG 3 65.1 CSN025 AAATAGACTTTGACCCTTTT GTCTGTATTTCAAATCTAACTC 4 2.8 SSR10368 TGTTCCGGCTCTTCAGAGAT GCCCGTATTTTATAAATAGTTTCATTT 4 70 CSJCT323 TCGATCTTGTAGAAAGCAAGGA CAAGCAAATTCCCATTCACC 4 0 CSN066 GGATCCGAAATAGAGAAAGGAAA GTTGTTTGGGTGTTAATGTGAAA 4 1.4 SSR2697 TGCTAACCCAACCAAACAAA CTGCCATTTCAAGCTATGGG 4 64.4 CU1791 AATGATGCACGAACAAACCA ATTGGCCCGAAGTAGGTCTT 4 98.8 SSR5899 TAAGAGCAAAAATCCCACGC AGCTCAATCAACGTCAAGAGAA 4 25.2 SSR1949 AGGAAAACCGGAAGCAGAAT TCCACAGAACAACCGTGAAA 4 2.3 SSR3598 TCAACAACAAGACAACCCCA TGGTCCCTTTTGATTTCTGG 4 5.2 SSR7130 CCACACACACACACAGTCACA TCCCATTGTCCCTCACTCTC 4 56.4 CSJCT42 GAGAGCCCCACCACCAGTCT GGATCCATGGCGCCTATAAATACC 4 52.2 SSR12 TCTCACCATGGTCACCTAATG GGTCATTGAAGAGTCAAGTTGG 4 22.8 SSR7209 CTGTCTGCAGAGCCATCTGA CCATCAAGTTGAGGAGCAAA 4 1.4 SSR2803 ATTGCTCCCAAGCAACTTGA ATTTCAAACCTCCAAGGCTG 4 28.6 CU1830 TCCTTTCCCCCATAATGACA GGTGGTTATGGTGGTGGTTC 4 46.2 SSR4482 GGAATGAATAAGTTCTGGAAGAAG CTTCCCATCAAAAAGCCTCA 4 55.5 SSR6225 TGTATCATTCCAATCCCTCCA CGAAGTCCAAATTGATAAAGGC 4 41.2 SSR203 AATAGCTCGAAAATGATGGCA CCTCAAAGAGGATCAAGCGA 4 71.4 SSR2895 GAGTTGGCAAGTCACGTTGT TTTCCCTCATTATGCCATCC 5 93.1 CSJCT435 TCAACTGGTAGTTGGGAAACCT CTGTCAATCAATGCTTCAGCTC 5 0 CSWTA13 AGATGGGCAGTTAGAGTTGATGCT CATTTAAAGCCTCATCAACACCTC 5 47.2 CSWTA04 TAAACATATGTGATTATACAGCAA GTGTTTTGGTGTTATGTGAATATC 5 0.5 GCM344 TCATCAGTCAGTAAGAGAGAGAGAG ATGTGACCTGATCCCATTGA 5 34.6