Nội dung

Respiratory Research BioMed Central Open Access Research IFN-γ, IL-4 and IL-13 modulate responsiveness of human airway smooth muscle cells to IL-13 Barry J Moynihan1, Barbara Tolloczko1, Souad El Bassam3, Pascale Ferraro2, Marie-Claire Michoud1, James G Martin1 and Sophie Laberge*3 Address: 1The Meakins-Christie Laboratories, Department of Medicine, McGill University, Montreal, Canada, 2The Department of Surgery, University of Montreal, Montreal, Canada and 3Respiratory Medicine Division, CHU Sainte-Justine, Department of Pediatrics, University of Montreal, Montreal, Canada Email: Barry J Moynihan - barry.moynihan@gmail.com; Barbara Tolloczko - barbara.tolloczko@mcgill.ca; Souad El Bassam - elbassams@hotmail.com; Pascale Ferraro - pascale.ferraro@umontreal.ca; Marie-Claire Michoud - marieclaire.michoud@mcgill.ca; James G Martin - james.martin@mcgill.ca; Sophie Laberge* - sophie.laberge@umontreal.ca * Corresponding author Published: 30 December 2008 Respiratory Research 2008, 9:84 doi:10.1186/1465-9921-9-84 Received: 3 March 2008 Accepted: 30 December 2008 This article is available from: http://respiratory-research.com/content/9/1/84 © 2008 Moynihan et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: IL-13 is a critical mediator of allergic asthma and associated airway hyperresponsiveness. IL-13 acts through a receptor complex comprised of IL-13Rα1 and IL-4Rα subunits with subsequent activation of signal transducer and activator of transcription 6 (STAT6). The IL-13Rα2 receptor may act as a decoy receptor. In human airway smooth muscle (HASM) cells, IL-13 enhances cellular proliferation, calcium responses to agonists and induces eotaxin production. We investigated the effects of pre-treatment with IL-4, IL-13 and IFN-γ on the responses of HASM cells to IL-13. Methods: Cultured HASM were examined for expression of IL-13 receptor subunits using polymerase chain reaction, immunofluorescence microscopy and flow cytometry. Effects of cytokine pre-treatment on IL-13-induced cell responses were assessed by looking at STAT6 phosphorylation using Western blot, eotaxin secretion and calcium responses to histamine. Results: IL-13Rα1, IL-4Rα and IL-13Rα2 subunits were expressed on HASM cells. IL-13 induced phosphorylation of STAT6 which reached a maximum by 30 minutes. Pre-treatment with IL-4, IL13 and, to a lesser degree, IFN-γ reduced peak STAT6 phosphorylation in response to IL-13. IL-13, but not IFN-γ, pre-treatment abrogated IL-13-induced eotaxin secretion. Pre-treatment with IL-4 or IL-13 abrogated IL-13-induced augmentation of the calcium transient evoked by histamine. Cytokine pre-treatment did not affect expression of IL-13Rα1 and IL-4Rα but increased expression of IL-13Rα2. An anti-IL-13Rα2 neutralizing antibody did not prevent the cytokine pre-treatment effects on STAT6 phosphorylation. Cytokine pre-treatment increased SOCS-1, but not SOCS-3, mRNA expression which was not associated with significant increases in protein expression. Conclusion: Pre-treatment with IL-4 and IL-13, but not IFN-γ, induced desensitization of the HASM cells to IL-13 as measured by eotaxin secretion and calcium transients to histamine. The mechanism of IL-4 and IL-13 induced desensitization does not appear to involve either downregulation of receptor expression or induction of the IL-13Rα2 or the SOCS proteins. Page 1 of 16 (page number not for citation purposes) Respiratory Research 2008, 9:84 Background Asthma and allergy have been associated with a Th2 polarized immunological response to otherwise innocuous allergens. This Th2 response is associated with increased levels of the interleukins IL-4 and IL-13 in inflamed tissues [1-3]. The Th2 paradigm has been successfully reproduced in animal models of allergen sensitization and challenge to antigens such as ovalbumin [4-7]. Animal models demonstrate a role for IL-13 in the development of airway hyperresponsiveness (AHR); overexpression of IL-13 in the murine lung induces a phenotype similar to human asthma, with excess mucus production, goblet cell hyperplasia, smooth muscle hypertrophy and AHR [8,9]. IL-13 and IL-4/IL-13 knockout mice are protected from allergen induced AHR [5,10]. Interferon-γ may counteract the actions of IL-4 and IL-13 in some circumstances. IFNγ knockout mice have been shown to have augmented Th2 responses and IFN-γ knockout mice have enhanced AHR following allergen challenge that is restored by administration of recombinant IFN-γ [11]. IL-13 and IL-4 signal through binding to their respective subunit of a receptor complex comprised of the IL-13 receptor alpha1 (IL-13Rα1) and the IL-4 receptor alpha (IL-4Rα) with subsequent phosphorylation of Janus activated kinases (JAKs) and the transcription factor signal transducer and activator of transcription 6 (STAT6) [12]. These pathways appear to be essential for the development of AHR as IL-4Rα and STAT6 deficient mice are protected from AHR [13-15] and reconstitution of STAT6 in the epithelium has been shown to be sufficient to restore IL-13 mediated AHR [16]. IL-13 also binds to the IL-13 receptor alpha2 (IL-13Rα2) with high affinity. The functional significance of this subunit is unclear. It may act as a decoy receptor to prevent excessive IL-13 signaling as it has a short intracytoplasmic tail [17-20] but there is also some evidence that it participates in IL-13 signaling [21]. IL-4 can drive many of the same processes as IL-13 through their shared receptor complex although IL-4 deficient mice are not protected from AHR [22]. Recent evidence indicates that cytokine actions on airway smooth muscle may be important in the pathobiology of asthma. The calcium responses to histamine, bradykinin and methacholine in human airway smooth muscle (HASM) cells are augmented by IL-13 [23]. The proliferative response of HASM cells to leukotriene D4 (LTD4) is also augmented by IL-13 [24]. The expression of the chemokines eotaxin, eotaxin-3 and TARC is also induced by IL-13, so IL-13 can be linked to the contractile, proliferative and secretory properties of HASM cells [25-27]. IFN-γ and IL-13 both increase HASM cell stiffness as assessed by magnetic twisting cytometry and reduce relaxation responses induced by isoproterenol [28]. We hypothesised that the Th2 cytokines IL-4 and IL-13 would http://respiratory-research.com/content/9/1/84 have different effects than the Th1 cytokine IFN-γ on IL-13 signaling in HASM cells. We chose to use STAT6 phosphorylation, eotaxin production and calcium responses as outcomes for IL-13 signaling. ASM is a primary effector of bronchoconstriction and IL-13 increases the contractility of HASM cells [23] and promotes STAT6-dependent eotaxin production [29]. Methods Cell cultures Primary cultures of HASM cells were prepared from lung transplant specimens as previously described [30]. Briefly, tissue digestion was obtained by incubating the tissues in HBSS containing collagenase type IV (0.4 mg/ml), elastase (0.38 mg/ml) and soybean trypsin inhibitor (1 mg/ml) at 37°C for 90 min with gentle shaking. The dissociated cells were collected by filtering through 125 μm Nytex mesh followed by centrifugation. The pellet was then reconstituted in growth medium (DMEM-Ham's F12 medium supplemented with 10% fetal bovine serum, penicillin 10000 unit/ml, streptomycin 10 mg/ml, and amphotericin 25 μg/ml) and plated in 25-cm2 flask. Confluent cells were detached with a 0.025% trypsin solution containing 0.02% ethylenediaminetetraacetic acid (EDTA). Cells were grown on glass cover slips for single immunofluorescence microscopy and calcium measurements or on 6 well culture dishes for flow cytometric analysis and for protein and mRNA extraction. Confluent cultures of HASM cells were serum deprived and supplemented with 0.1% bovine serum albumin, 5 μg/ml insulin and 5 μg/ml transferrin 24 h prior to cytokine treatment. Cells at passages 3–6 were used in all experiments. Immunofluorescence microscopy Serum-starved human HASM cells were cultured to semiconfluence on coverslips, washed with PBS, fixed for 20 min at RT in 4% formaldehyde in PBS and incubated for 1 hour with 10% FBS in PBS before the addition of the primary antibody. The cells were then incubated for 1 hour with the following primary antibodies used at the appropriate dilution: anti-IL-13Rα1 mAb (CD213a1, Diaclone, Besançon, France), anti-IL-13Rα2 (CD213a2, Diaclone, Besançon, France), anti-IL-4Rα (CD124, Pharmingen, BD Biosciences, Mississauga, Canada). These primary antibodies were detected with Cy2-conjugated goat antimouse IgG (dilution 1/50). Slides were washed twice with PBS and counterstained with nuclei stain DAPI for 5 min. As controls, cells were processed either in the absence of the primary antibody or using an isotype control. After washing, coverslips were mounted on glass slides, visualized with a Zeiss Axioskop 2 microscope and photographs were taken using a SPOT camera with SPOT RT software (SPOT Diagnostic Instruments). Page 2 of 16 (page number not for citation purposes) Respiratory Research 2008, 9:84 Flow cytometry analysis Cells were treated with IL-4, IL-13 or IFN-γ at various concentrations for 24 h. Cells were washed with PBS, detached with a non-enzymatic cell dissociation buffer and then washed with staining buffer (Dulbecco's PBS, 1% heat-inactivated FBS, 0.09% sodium azide) and centrifuged. After blocking Fc receptors, cells were incubated for 3 h on ice with either anti-IL-13Rα1-PE (Diaclone, Besançon, France), anti-IL-13Rα2-PE (Diaclone, Besançon, France), or anti-IL-4Rα-FITC (Pharmingen, BD Biosciences) monoclonal antibodies. Isotype-matched mouse antibodies were used in all experiments. Cells were fixed in 2% paraformaldehyde. Flow cytometric acquisition and analysis of samples were performed on at least 10,000 acquired events on a FACScan (Becton-Dickinson, Oakville, Canada). Dead cells were excluded by gating out propidium iodide-positive cells during assessment of cytokine receptor surface expression. Analysis was performed using Cell Quest software (BD Biosciences). RNA isolation and real-time RT-PCR Total RNA was isolated from HASM cells using TRIzol reagent (Invitrogen, Carlsbad, CA), according to the manufacturer's instructions. Extracted total RNA was dissolved in RNA-free water, quantified at 260 nm and 100 ng of total cellular RNA was used for analysis. One-Step quantitative real-time RT-PCR was conducted using the QuantiTect SYBR Green System (Qiagen, Mississauga, Canada) on a Mx3000P cycler (Stratagene, La Jolla, CA). The sequences of the specific primer pairs that were used for each gene of interest are displayed in Table 1; specific primers were used at a final concentration of 1 μM. The reverse transcription was done at 50° for 30 minutes. Cycling conditions were one cycle at 95°C for 15 min, followed by 45 cycles of denaturation at 94° for 15 s, annealing at 60° for 30 s and extension at 72° for 30 s. Melting curve analysis was used to document the amplicon specificity. Calibration curves were generated by measuring serial dilutions of stock cDNA to calculate the amplification efficiency. The relative amount of mRNA for each tar- http://respiratory-research.com/content/9/1/84 get gene was normalized to the value obtained for the housekeeping gene 18S. Protein extraction and Western Blotting Confluent cultures of HASM cells were serum starved as above. After stimulation, cells were washed with ice-cold PBS and lysed. Samples were sonicated, boiled and protein content was quantified using Bradford assay. Equal quantities of protein were loaded per lane. Electrophoresis was carried out by using 8% (Phospho-STAT6, STAT6, rabbit polyclonal IgG, dilution 1:1000, UpState, Lake Placid, NY, USA; Phospho-ERK, ERK, rabbit polyclonal IgG, dilution 1:1000, Cell Signaling Technology) or 15% (rabbit polyclonal anti-SOCS-1 IgG, dilution 1:1000; mouse monoclonal anti-SOCS-3 IgG, dilution 1:1000, Abcam Inc, Cambridge, MA) SDS-PAGE gel and proteins were transferred to nitrocellulose membranes. Membranes were blocked for 1 hour at room temperature for STAT6 with 5% dried milk in Tris-HCl containing Tween 20 (TTBS) or 1% BSA with EDTA and NaCl in TTBS for SOCS-1 and SOCS-3. The membranes were incubated with primary antibodies overnight at 4°C followed by incubation with secondary antibodies (goat anti-rabbit IgG HRP conjugated, 1:1500, Upstate, or donkey antimouse IgG HRP conjugated, Jackson Immunology, dilution 1:10000, as appropriate) at room temperature for 1 hr. Blots were developed by chemiluminescence and the signals were recorded with Fluoro™ 800 Advanced Fluorescence Imager (Alpha Innotech Corporation, Montreal, Qc, Canada) and densitometry was performed with Fluorochem™ software. Negative controls without primary antibody were performed for all primary antibodies. Blots for β-actin, STAT6 and ERK were performed in parallel to verify comparable protein loading. ELISA Eotaxin release in supernatants was analysed by means of ELISA (R&D Systems, Minneapolis, MN) according to the manufacturer's instructions. Every measurement was performed in duplicate. Table 1: Primers used for real-time polymerase chain reaction analysis of gene expression. Gene Forward primer (5' to 3') Reverse primer (5' to 3') Product length (bp) IL-13Rα1 atctcacccccagaaggtgat cgggactggtattccttc 119 IL-13Rα2 cctttgccgccagtctatctta tcaaaacaccttgctggaatagg 108 IL-4Rα gctatgtcagcatcaccaagattaa cccctgagcatcctggattat 101 SOCS-1 ggaactgctttttcgccctta agcagctcgaagaggcagtc 127 SOCS-3 gtccccccagaagagcctatta ttgacggtcttccgacagagat 118 Page 3 of 16 (page number not for citation purposes) Respiratory Research 2008, 9:84 Measurement of intracellular free Ca2+ HASM cells grown on 25 mm diameter coverslips were used 10–14 days post plating. Cells were incubated for 30 min at 37°C with Hanks' buffer (in mM: NaCl 137, NaHCO3 4.2, glucose 10, Na2HPO4 3, KCl 5.4, KH2PO4 0.4, CaCl2 1.3, MgCl2 0.5, MgSO40.8, N-2-hydroxyethylpiperazine-N'-ethane sulfonic acid [Hepes] 5) containing 5 μM Fura-acetoxymethylester (Fura-2-AM) and 0.02% pluronic F-127. The loaded cells were then washed and the coverslips placed in a Leiden chamber (Medical Systems Corp, Greenville, NY) containing 450 μL of Hanks' buffer on the stage of an inverted microscope equipped for cell imaging with a 40× oil objective (Nikon Corp, Tokyo, Japan). The cells were imaged using an intensified camera (Videoscope IC 200) and PTI software (Photon Technology International Inc, Princeton, NJ) at a single emission wavelength (510 nm) with double excitatory wavelengths (345 and 380 nm). The fluorescence ratio (345/380) was measured in individual cells (n = 8 per slide) and the free [Ca2+]i calculated according to Grynkiewicz's formula [31] using a k.d of Ca2+ to Fura-2 of 224 nM Rmax was determined in cells exposed to ionomycin 10-5 M in the presence of 1.3 mM CaCl2 and Rmin in Ca2+ free buffer to which EGTA 10-3 M and ionomycin 10-5 M had been added. Background fluorescence and autofluorescence were automatically subtracted. Statistical analysis Results are expressed as means and standard deviation values. The statistical analysis was performed using oneway ANOVA for repeated measurements followed by the Dunnett test for multiple comparisons. Statistical significance was established at a 5% level of confidence. Results HASM cells express IL-13 receptor subunits and IL-4, IL-13 and IFN-γ inhibit STAT6 phosphorylation induced by IL-13 The expression of the IL-13 receptor subunits in HASM cells was examined using RT-PCR and immunofluorescence microscopy. RNA preparation from cultured HASM cells revealed mRNA expression of the IL-13Rα1 subunit, the IL-13Rα2 subunit and the IL-4Rα subunit (Figure 1). We confirmed the expression of all the subunits by immunofluorescence microscopy (Figure 1). The IL-13 receptor complex was functional as evidenced by STAT6 phosphorylation following stimulation with IL-13 which reached a maximum by 30 minutes after stimulation. A dose-response curve of STAT6 phosphorylation showed that the peak response to IL-13 was observed at a concentration of 15 ng/ml (Figure 2). We chose the submaximal concentration of 5 ng/ml of IL-13 for all subsequent experiments investigating the effects of cytokine pre-treatment on IL-13 receptor activation. http://respiratory-research.com/content/9/1/84 To assess the effects of Th2 and Th1 cytokines on IL-13 receptor activation, HASM cells were treated with increasing concentrations of IL-4, IL-13 and IFN-γ for 24 hours prior to IL-13 stimulation. No wash was performed prior to IL-13 stimulation in order to better reflect the in vivo state by a continuous exposure to cytokines in the culture milieu. Pre-treatment with all three cytokines significantly reduced peak STAT6 phosphorylation in response to IL-13 which was not associated with reduced total STAT6 expression (Figure 3). The magnitude of the effects of IL-4 and IL-13 pre-treatment on STAT6 phosphorylation induced by IL-13 was higher than that seen with IFN-γ pretreatment. From these experiments, we chose to use the cytokines at the following concentrations for all subsequent experiments: IL-4 and IL-13 (5 ng/ml) and IFN-γ (10 ng/ml). The effects of cytokine pre-treatment on phosphorylation of ERK, another kinase associated with IL-13 receptor activation, was also studied. Cytokine pre-treatment with either IL-4, IL-13 or IFN- γ did not alter IL-13induced ERK phosphorylation (data not shown). IL-4, IL-13 and IFN-γ increase expression of IL-13Rα2 in human airway smooth muscle cells To investigate whether changes in receptor expression could account for the inhibitory effects of cytokine pretreatment on STAT6 phosphorylation induced by IL-13, HASM cells were treated with IL-4, IL-13 or IFN-γ for varying time periods and mRNA expression of IL-13 receptor subunits was assessed by real-time RT-PCR. As shown in Figure 4, IL-13Rα1 and IL-4Rα mRNA expression was unaffected by cytokine treatment. Both IL-4 and IL-13 increased expression of IL-13Rα2 mRNA by 3 to 4 fold over control but IFN-γ had no effect. The effects of cytokine pre-treatment on IL-13 receptor subunits mRNA expression were associated with changes in surface expression of receptor subunits using flow cytometry. HASM cells demonstrated low resting cell surface expression of all IL-13 subunits. As observed at the mRNA level, IL-4, IL13 or IFN-γ did not alter the expression of the IL-13Rα1 (mean fluorescence intensity: non-stimulated: 2.5 ± 0.2; IL-4-stimulated: 2.45 ± 0.1; IL-13-stimulated: 2.5 ± 0.1; IFN-γ-stimulated: 2.45 ± 0.1, n = 3) and IL-4Rα subunits (mean fluorescence intensity: non-stimulated: 3.15 ± 0.75; IL-4-stimulated: 3.0 ± 0.3; IL-13-stimulated: 2.95 ± 0.3; IFN-γ-stimulated: 3.1 ± 0.2, n = 3) indicating that cytokine pre-treatments did not induce downregulation of these subunits on the cell surface. However, IL-4 and IL13, along with IFN-γ, significantly up-regulated IL-13Rα2 cell surface expression in HASM cells as determined by both the percentage of positive cells (Figure 5) and the mean fluorescence intensity (non-stimulated: 7.26 ± 2.52; IL-4-stimulated: 25.63 ± 10.09; IL-13-stimulated: 24.82 ± 7.96; IFN-γ-stimulated: 22.43 ± 4.42, p < 0.05; Figure 5). All three cytokines significantly increased IL-13Rα2 Page 4 of 16 (page number not for citation purposes) Respiratory Research 2008, 9:84 http://respiratory-research.com/content/9/1/84 Figure 1 of IL-13 receptor subunits in cultured HASM Expression Expression of IL-13 receptor subunits in cultured HASM. The following primary antibodies were used: anti-IL-13Rα1 mAb, anti-IL-13Rα2 mAb and anti-IL-4Rα mAb. These primary antibodies were detected with Cy2-conjugated goat anti-mouse IgG (green). Slides were counterstained with nuclei stain DAPI (blue). As control, cells were processed in the absence of the primary antibody and/or the secondary antibody. mRNA transcripts for all subunits in HASM cells obtained from two different subjects are also shown: lane 1: IL-13Rα1; lane 2: IL-13Rα2; lane 3: IL-4Rα. Page 5 of 16 (page number not for citation purposes) Respiratory Research 2008, 9:84 http://respiratory-research.com/content/9/1/84 Figure 2 Concentration-dependent effect of IL-13 on STAT6 phosphorylation Concentration-dependent effect of IL-13 on STAT6 phosphorylation. HASM were stimulated with IL-13 for 30 minutes. Levels of phosphorylated STAT6 in cell lysates were detected by Western blot analysis using antibody that recognizes the tyrosine-phosphorylated forms of STAT6. A: representative Western blot film. B: Detected phosphorylated STAT6 band densities were measured and densitometric values presented as mean values ± SEM of two independent experiments. Page 6 of 16 (page number not for citation purposes) Respiratory Research 2008, 9:84 http://respiratory-research.com/content/9/1/84 Figureof3 IL-4, IL-13 and IFN-γ pre-treatment in STAT6 phosphorylation and total STAT6 protein induced by IL-13 Effects Effects of IL-4, IL-13 and IFN-γ pre-treatment in STAT6 phosphorylation and total STAT6 protein induced by IL-13. HASM cells were pre-treated with various concentrations of IL-4 (n = 3), IL-13 (n = 3) or IFN-γ (n = 5) for 24 hours and then stimulated with IL-13 (5 ng/ml) for 30 minutes. Whole cell lysates were extracted and subjected to Western analysis using antibodies that recognize total and phosphorylated forms of STAT6. A: Representative Western blot films. B. Detected phosphorylated – STAT6 band densities were measured and the densitometric values were normalized to the IL-13-stimulated value. Data are shown as the mean values ± SEM of 3–5 independent experiments. * p < 0.05 compared to IL-13 stimulated value in the absence of cytokine pre-treatment. expression at concentrations as low as 1 ng/ml (data not shown). Since the reduction of IL-13-induced STAT6 phosphorylation following IL-4, IL-13 or IFN-γ pre-treatment was associated with increased expression of IL-13Rα2, we investigated whether blocking the interaction between IL13 and this subunit could restore the IL-13-induced STAT6 response. To this end, HASM cells were pre- treated with either IL-4, IL-13 or IFN-γ for 24 hours prior to IL-13 stimulation in the presence or absence of a neutralizing concentration of anti-IL-13Rα2 polyclonal antibody (5 μg/ml) added to cell cultures 1 hour prior to stimulation with IL-13. The antibody had no effect on IL-13- induced STAT6 phosphorylation per se. Figure 6 shows that the inhibitory effect of pre-treatment with either cytokine on IL-13 induced STAT6 phosphorylation was not altered by the addition of anti-IL-13Rα2 antibody used at a concen- tration that blocks 50% of the binding of 100 ng/ml of rhIL-13 to immobilized rhIL-13Rα2/Fc Chimera (a dose of IL-13 twenty times in excess of the concentration used in our study), according to the manufacturer's specifications. This antibody used at a slightly lower dose (4 μg/ ml) has been shown to be effective in blocking IL-13Rα2mediated effects on HASM [32]. IL-4, IL-13 and IFN-γ upregulate SOCS-1 but not SOCS-3 mRNA expression in HASM cells SOCS-1 and SOCS-3 are members of the family of suppressors of cytokine signalling (SOCS) proteins involved in the negative regulation of signalling induced by IL-13 and IL-4. To investigate whether the inhibitory effects of IL-4, IL-13 and IFN-γ pre-treatment on STAT6 phosphorylation induced by IL-13 may be related to the induction of such proteins, the effects of IL-4, IL-13 and IFN-γ on the expression of SOCS-1 and SOCS-3 were determined at the Page 7 of 16 (page number not for citation purposes) Respiratory Research 2008, 9:84 http://respiratory-research.com/content/9/1/84 Figure Time-dependent 4 effects of IL-4, IL-13 and IFN-γ on IL-13Rα1 (A), IL-4Rα (B) and IL-13Rα2 (C) mRNA expression Time-dependent effects of IL-4, IL-13 and IFN-γ on IL-13Rα1 (A), IL-4Rα (B) and IL-13Rα2 (C) mRNA expression. HASM were incubated with vehicle, IL-4 (5 ng/ml), IL-13 (5 ng/ml) or IFN-γ (10 ng/ml) for 3, 6, 12 and 24 hours. Receptor subtype and 18S mRNA expression was quantified using real-time PCR. Data are expressed as the relative expression in receptor subtype/18S mRNA ratio and compared to unstimulated (vehicle) value of 1 at time 0, for five independent experiments. * p < 0.05 compared to cells treated with vehicle (ANOVA). Page 8 of 16 (page number not for citation purposes) Respiratory Research 2008, 9:84 http://respiratory-research.com/content/9/1/84 Effects Figureof5 IL-4, IL-13 and IFN-γ on cell surface expression of IL-13α2 receptor Effects of IL-4, IL-13 and IFN-γ on cell surface expression of IL-13α2 receptor. A. Representative flow cytometric analysis of IL-13 receptor subunits expression in resting cells. B: Representative flow cytometric analysis of IL-13Rα2 expression in unstimulated cells and cytokine pre-treated cells. C: HASM cells were incubated with vehicle, IL-4 (5 ng/ml), IL-13 (5 ng/ ml) or IFN-γ (10 ng/ml) for 24 hours. Percentage of positive cells in unstimulated cells and cells treated with IL-4, IL-13 and IFN-γ were assessed by flow cytometry and data presented as means ± SEM for 9 independent experiments * p < 0.05 compared to unstimulated cells (ANOVA). Page 9 of 16 (page number not for citation purposes) Respiratory Research 2008, 9:84 http://respiratory-research.com/content/9/1/84 $ % 367$767$7  367$7 ,)1  QJPO 9HK9HK $QWL,/5   QV QV   ,)1 QJPO $QWL,/5  &             ' 367$7 67$7 3UHWUHDWPHQW,/,/9HK,/,/9HK $QWL,/5  Figure Effect of6blocking IL-13α2 on cytokine-mediated inhibition of IL-13-induced STAT6 phosphorylation Effect of blocking IL-13α2 on cytokine-mediated inhibition of IL-13-induced STAT6 phosphorylation. HASM were pre-treated with IFN-γ (10 or 100 ng/ml), IL-4 (5 ng/ml) or IL-13 (5 ng/ml) 24 hours prior to IL-13 stimulation in the presence or absence of neutralizing concentration of anti-IL-13α2 polyclonal antibody (5 μg/ml). Phosphorylated STAT6 expression was assessed by Western analysis. A and C: Representative Western blots. B and D: Band densities were measured and the densitometric values were normalized to the IL-13-stimulated value. Data are shown as the mean values ± SEM of three independent experiments. * p < 0.05 (ANOVA). mRNA and protein levels. IFN-γ and IL-4 significantly upregulated mRNA expression of SOCS-1 but had no effect on SOCS-3 mRNA expression (Figure 7). The increase in the expression of SOCS-1 mRNA following IL13 stimulation did not reach statistical significance. Despite induction of SOCS-1 mRNA, we did not detect a significant change in protein expression by Western blot analysis. Effects of cytokine pre-treatment on IL-13-induced eotaxin release To assess the impact of IL-4, IL-13 and IFN-γ pre-treatment on a STAT6-dependent physiological outcome [29,33,34], we measured eotaxin release (Figure 8). Preliminary experiments revealed that significant but submaximal eotaxin release was observed when HASM cells were stimulated with IL-13 at a concentration of 5 ng/ml as compared to a higher concentration (5 ng/ml: 1040 ± 135 pg/ Page 10 of 16 (page number not for citation purposes)